Description :
From Genome Similarity Track
Location :
Scaffold_35:3087- 6438
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_35-fgenesh-gene-0.1Vesicle-associated m (ISS)
Pytiw_DAOMBR242034maker-piw_contig_35-fgenesh-gene-0.11Ids4

Sequence
3351 bases(100 bases per row)
GCCTCGTAAAGTTCACCATGGCGAACACTGGCGGAGTCGACGTGTCGCTCGCGCCCAACTCGAACGTGATCCTCGAACCGGCCGAGTCGCTGTCGTTCCA
CCTGCAGCCGCAGGCGGCCCCGCAGGCCGTGCTCACGATCCGCAACGTCTCGGAGAGCCGCAAGATCGCGTTCAAGGTCAAGACGACGCGCCCGCTGCGG
TACCTCGTGCGCCCGAATCAGGGCATGCTCGGCCCGAACGGCACGGCCTCGATCATGGTCATCCTGCAGCAGCGCGACTGCGACGAGCTCCTGCGCCTCG
AGCCATCGGAGCGCCAGCTCTCGAACGACAAGTTCCTCGTGCAGAGCATCTACGCAGACGACGGCTTCTACGAGCTCGTGAAGACCAAGTCAGCCAAGGA
GATGGCCGACGACCTCACAAATATGTGGGCGCACACGGACAAGAAGAGCCTCTCGAACAAGAAGCTGCGCTGCCGCTTCGTGCAGGACGACCAGCAGAGC
GGTGCGATGACAGGGAACGGCCAACAGGTGACGCTCAAGGCCGAGAGTCCGCTCTCGTCGCGCTTCCCGTCCAAGAGCAGCATCTACAGCAGCAGCAACA
GCCTCCTGCCTCAGCACCAGCCGAGCCTGGGCGACGAGCCATCGGCGCATCGACCCAGCGAGGACGTGGCCACGCCAGCGCAGCTGACGGCGGCGCTGCT
TCAGGAATCGGCGGCGGAGAAGGCCGTCCACCACAAGACTGAGCACGCAGTCGCAAAGGTACAGCAAGCAACAACAACATTCTTATGGCGTTGTTATCTG
TGGTGAGATCAGTACTGACAGCTAACTGTCTTTGTTGTTGATTTACGCGAGCAGCACGAGATGTCCGAGGTGGCGGCGTTACGGAAGAAATACGACGAGC
TCGTGGCGTTCACCGTGCAGCTCACGGCCCAGCGCGACGTGCTCATGACCGACCTCGAGAAAACATATCCTTCTTTATTACGATGCATGTTTGTATTCTT
TTGCGTGTCACTCGAGGTTCATGTGATTCTGTCGATGGTACTCCTTGACCGATTTTGTTCTGTTTTGTTTTCCTGATCCGAGTACGCGCCAGCTCTTGCA
GAAGGCGAGTTCGGATGCGCAGCGCGTGAAGAAGCTGAACGAGGACGCACCCAACGGCGGCTCAACACTGCGCCAACGCAAGCCTGGTGCCGCGGGCACC
TCCAGCGACGACGCGCAGCTCTCAAAGACAGCGACGGGAGGCAAAGACCCGGCGGTGAGACCTTGATAACCATTGTTGAACATCTACTGATGGGGTGGCT
ACATTGGTACTAACGGAGCTCTTCATATGTATGTCTTGTGTGGCTGGCTGTAGGCGTTTGGTCTGTTCCATCTACTTGTGTGCGCGATCATTTTCTTTTT
GGTGGGGCGCTACGCGTGAGTCTACTCCAACAACCGTTAACCAAGCGAGACGATGTCGCTGCTGCGTGGAGGATCGTCTGTGGATAGAAGCGTCAAGCGA
CAACAGCGTGTGGGAGTTAGTTCGCACTGCTGATGAGACCCAAGCGCTATGCAAGACCCCAACGCCAGCAGCTACGAAATTATGAGGAGAGACGACGAGA
GAGAAAGACGAAGAAACAAGAACCAACTCGACAAGGACTGACTGGTGTGTGTGTGTTTTCCATTCTATCGTGCCACTGCGTCGTCCTTCATATTGCATCA
CCCCCTGCTCTGCTTCGCTTCTCCTCACGTGCGTTGTTCCTAACTACCTTACTCCTTCCTGTACACGCTGCCCAAAGTTCCTACCGAAACGCCAGTCACT
TCACGATTTGCACTCTGCTGCCTAATTGAGAATGGTCGCGAAGCTCATCTTGCGCTTGCCGTTGCTGCTGCCGACACCTGCGAGCGGCACGAACGCCTTG
CGCTTGAACCGACGGCCGTCGGGGCCGCTGCTGTTGCCGCCATCGCTGCTCATGGCACCGCCTCTGCCGCCAGCCAAGCTCTCTTTCATGGAAAGCATCG
CGATCGCCGCCGCATCGCTGTCAGAGTGGTGGCCGCCGTGCCTTGGTGCGAGAGGCTTGACATCCACGATTGAAATGGGTGGCCTCACAGTATTAACAGC
TGTCTGGACGGCGCCACTCTCGTCTCCTCGTGGCGGCGATGATCCAAAGCGGTCGTCGTCGTCGTCCTGGTCGTCGTCCTGGTCGTCGTCCTCGCCATCG
TCGTCCTCGTCGCCGTCGTAGTCGCCCACGCTCTCCAGTTTCTTGAGCTGCCATGCGTCGTCGCGAAGCGCGTGCACTCTCGTGAGCGGCACCGAGTCCT
CCGAGCGCGGCGACAGGTCGCGTGTGAGCTGGTCGTCGCCTCCTCTTCCTGCCTGGTATTCCCCATACGTCGTATCTCCTGCTCCTCGTCCCGTCGACGA
CGGTGGTGTGTTTCCTGGTGTGTACGTGCTGCTGTTGTTCTGGTTGGACGGCGACGATGTCCTCGAGCCATTGCCGCCATTGTTGCTCCTGCTACCGTTG
TTGGACGAGAACGAACCGCCCGCGCCGCCGCCGCCACGTCGCTCGCTCTTCTGCGCGTCGTGGGCCTCGATGCTCGAGCCCGTGGCCTCCATGAAGATGT
GTTCGAGGCGATCGATCATCTGCAGCAGCGGCACGTAGGTCGCAAAGGGCTGCTTCATCAGGATCGTGTGCATGAACTTGTGGCGCGTCGCGTAGCCCGT
CCACTTGTCGTGCTTCTTGAGGATCTTGGAGATGCCGCAGAAGTTCATCACGGCAAAATTCTCGAGCAGCAGCAGCTCCTTGTAGAGCGCCACGCAGCGC
TTCATGAGTTCCGTCTTGGTCTCGGGCGTCGGCGCCGACTGTACGTACACACACGCAAAGACCAGAGCAAGACGCGTGAGATTCGCATCACCATCCTACA
GATAAAAAGCGTGTAGCAACAGCACATACCTTAAGCGCAATCGAGAGCTGCTCGATCGCAGCCACCTGGCTCGTGTGCCTGGCCTGCTCGTGCACAAAAA
AGTCCGCGATCTTCTTGATCTCGACGCGCAGCGTGCGGAAGAAGTTCATCTCGTCGGGCGACTTGCCTGCTCACAGCAAAACGCTCATTAGCAATCGCCC
ATTCCATGCAGAGAGACACACGTATCACTACACGTACGGATGCTGTCGTTGTCCTCCTTGGCGGACGGCTTGATCTTGGTCTTGACGAGCTTGTCGCCCT
GGAGCTTCTCCTCCTTCTTGATGTGCGCGCAGTCCTTGATGATGTGTTTGAGCTGCTTGTAGTCCACCCAGTGGGCCTCCCACGACGTCGACGACATCTG
CATCGACTGCTGCAGCACCTTGCCGAACTTCATGGTTGCTACTCGCCTTGT