Description :
From Genome Similarity Track
Location :
Scaffold_8:308682- 311339
Transcript NameFunction/comments
Physo_260772neutral zinc metallopeptidase, Zn-binding site
Physo_338908Major Facilitator Superfamily (MFS)
Physo_338909Major Facilitator Superfamily (MFS)

Sequence
2657 bases(100 bases per row)
AAACAAATACGTGAGCGCGGCCGACGTCGATTGGGGTCTGGGATAATCGAATTGGACCCGACGCGAAGGTGAAGGTCAATGTCAACTGGAACGTCATGGA
AAACAAGAACTGGATCTTGGACCGCATCGTGAAAAACAAGGGCATGCTTAACTACTGCGTGCGCTGGGACAGCACGGAAAAGCTCTCCAAGGCGACAGCG
TCTAAATTCCAGGCTATGCTGGAGCGTCAGTACGCAGCGTGGAACCACTGGCTCATTGGTTACGACTGCTGACCGTACAACAAGATCAAGACCAACGTTG
TGGGATTAGCTGTCAAGGACGCTACTTTGCTGGATTGGGAAGACGACTCACTCGGCACGATCACCGTGGGGGACTCGACAAGGATGGCGTACGGCAGTGC
GACCAAAAGTGCTACCGCTTCTACGATGTTGGCATCAACGCGTGGACTGATACTAGCGGGTGCAAGGGTGAGCCAATTGATCTTTCACTGTGGCCCAAAC
AGGGACTGGCAGGTGGATTCGGATTCGACTGGGGCCAGGAGGTAAACCTCGAGAACATGTTGGCGATGCTCGACGAGGACCAACTCACAATTGTCGCCCA
CGAGATCGGTCACGGCTTCGGGCTTCCTGACTTCTATGAGGCTACCGACAAGCCCAACGCCAAATGGCCCAACTGCATCATGATGGCCGGGAGTTCCCCA
ACTGTCACGGACAGTGATGACTGGATGCTGCGTCGTGTCCTGGAGCATCTCAAGTCTCGCTACAAGTTCTAGACGACTGAAATGTCATTTGGACGATTTG
TGAGGTGCAGTACGGTAGGTGAGAAACGCGTGTTTATTCCTGTTACATTTACTAGTAGTAATACGGTAGTAGCACACATCATTTCTTTATGATGCTATTA
GTATTGTAAGCACACCGAACTGCTACTACACTACTACGTAGTACTACATACTAGTACTTCCTGTATCGTTCAAAACACTAGCAAATAGTATATTTCCAAT
ACTACTACTTTCTAGTACTAGTAGTACGTAAACAATCCACACGAAGACTCGTTGTACATGCAGCTTACTTTTCGCGACGCGAGTCGTACTCGGCCAGGAT
CTCCTCGGCCGACTTGCCCGACGTCTCCGACACCAACTTCAGCGCCAGCAGGAAGAAGATCGCCAGCAACACCACGAACGGAACGTACGCGTAGTCGTCG
AGCGCGTCCGAAATGTACGGGTACGCCACGCCCACGATGAGGTTGCACAACCAGTTCATGCCAATACACAGCGACGACGCGCTGGCGCGGATCGAGTCCG
GGAAGAATCGGCCGTCATCACCCACACCAGGGGACCCAGCGTCACGCCGAACGCGATCACGTACAGCGCAGTGAACACGATCGACAGAGCAGACACGTCC
ACGATGAACGCCACCGTCATGAGCACCGACATGACAAACATGCCGGCCAGACCCCACAGGATCATGTTACGGGCGCCAAAGCGGTTGGCCAGCACGCCCG
TGAAGAAGGCCGGCCAAGTCGATGATGAGCGTGCCCACGCGCGAGTCCGAGATGCCGGCGTCCGAGAAGATGCTGCCCGAGTAGTAGAACACGGCGTTGA
TGCCCGACAGCTGCTGCGCGCAGGACAGCAAGATGCCGCCCAGAAGCTGCATGCGGTAGCGCGGCGCGAACATGGACTCCTGCTTGGGAGCAGCCAGACC
CTCCTCGGCGGTCTCCGGCTTCTTGTTTACCTCCAGCCACGACATGGCCGTCTGCACGTGCTCCTCGCCGTACAGACGAGCGATGACCTGCTTGGCCTCC
TCCGTGCGGCCCTTGGTCAGCAGCCACGCGCGACTCTCAATGCACATGGACGGCGCCAGCACCATGTAGATCACGGCCAGGATGCACGGGAACGCGGCCA
GGTAGCGCCAGCCAGAGCTCGTGTTGGCGAAGAAGAAGCAGATCGCGGGGAACAAGATGCCGATGGTGGTGAAGATCTGCAGCCCCAGGTCCAGCGTGTT
GCGCATGGGCGGCGGAGACAGCTCGTTCACGTACGCGCCGATGGTGCCCGTGGCAGTGCCCGACGACAGACCGGCGATCAGACGGCCGGCGGCGAACGCC
CAGATGTTGGAGACGGAAGCTTCGACCACGCCGCCCACAAACATGAAGATGCAGTTGAGCATCAGCGTCTTCTTCCGGCCGAGGCGGTCGCTGAAGTGGC
CGCAGCACAGAGAGTCGATCATGGCGCCGAAGATCCACGCGTTCACAGCGAACGTCCACTCCAGCTTCGAGTGGCCGGGAACATGAGGCACGTGCCCTCG
GCCACGGGGCGCGCATTGCACTCGTCCGTGTCGTTGTACTGCGAGAGGTTCGTCTGCGAGGTGGACCAGCCGCTCTGGAACGGCTGCAGCCACGACAGGA
ACGCGCTCGTGTACAGGATGGCCTTGGGCTTGATCAGACGTGCGGCGGCCTTGTTGGCTTCGTCGAACGCCGTGGTGTTGGCCTTGGGCGTTGTGGCTTC
CGTGTAGTTGTCCGCCATGCTTGCCTTCCTACTAGCTCGCTCGCTCGCTCGCTTGCTTGATTCACTTGACTTGGTTGGCGACTGCTTGGCCAAATGGAAA
GTGAGTGACCGATACCAACTCAACGTCGAGACCTACCGGAGACCGATAGCGGTCTCG