Description :
From Genome Similarity Track
Location :
Scaffold_191:3086- 8656
Sequence
5570 bases(100 bases per row)
ATGGACCAACTGCTGCAGCGTTGAGCGCTGCCGAGACCCCAATTGGTGCATTTTTTCAGTTCGTCCCGCCGTACGTACTAGAAAGAATTGCGGGTGCTAG
TAACGACTATTTTATGGAGAACCTAGACGCGCGAGTGGAGAGTCTACACGCCAAGCAGCTAGATAGGAAGCTGAAAAGGCTTGATTTCCATGTCTCACCT
CCGGATATCATAAAGACTAAGCTGCTGAACACGAAGGACATTTCAGGACGAGAAATTGCTATTTTTCTTGGAATACGATACGAGCACGTGTGCGGTAGCG
CAAACAATACTGGTGGGTGTGGTAAGTCGAACTGTCTGTACGCAGTACTACACTTTAGTGCCCTGTCCATAATGGTCGAGATAAGAGCTCGGCTCAGTTG
CGGGTGGCGATAAGGTGTATCCGCCGCGCGCGTAGATACTGCGTTGAATACAAGTGACAGACGCGCGGTCAGCTTGCCAGTATCGCTGCAGTATGGCCTG
TGCCCAGTTAGTGACCTGCTTGGTCATATAGACTGATACATCAGAAGCGTAAGCACAGTAACCCAGCACGACGACGCAAATGTACCGAGAGAGCGACAGT
GACCCTATACATAGGTTTTAGATATCACGAGCGCGTGGTATACACTCATTAATTTTTTTTTTATATATGCACGAACATATCAAATAGCACGGTGTTGTGA
TAATTCGGCGGCATAATTACTTCTCATAATAATGCACATGAACTACTTTTCAGATTAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTTTCATTAAGTCCGGATATCTTGGCGCGGGACCGTGG
AGGTAACAACGACTTGCCAGTGTGTATAGTACAGATTTTTCAACATAAAGGAGGGTTTATGTAGTACATTGAGACGATCAGGGTACAACTATGCTGGATA
AATAAACATAAGATATGTACTGTTTATTGATTAGCCTATCTTTGTGCTGTTGCGTACGTCCAGCAGCGGTGAGTTCATTTATTATAGCCAATAACAAGAA
AGATCAAGGGGCGGATCAATTGATTGCTCCTTGCATAGACATGTACGACCAGACGGCGCAACCATTTCTACTCCTTCCTCCTCCCGCGTTTCATCATCTT
CTTCGCTCGGCTCCCCAGCAGCAGCACCAGCACTTGCTCCGTTTTTCTTCGACCTGATGTCTGTCGTCTCCGCTTCTTGCCTGGACGCTCCGCTGGCGCT
CGGTCGCGTATCTTGTGGTCGCGTAGCAAGCGGCTCGGGATGTCATTTTCGTTCTTCCAGTCGAGGTGCCATATCTGAAAGCACGTGCGCTCCCTTTCCT
CCCTAACAACGTTGCAGTCCTCTGCTGTTCCAAGTCTGCATACTGCATCAGGTAAGGAAAAGAGCGTGCCTTCGGGCACGCTCTTTTTTTTTAGGTTTCA
AAGTTACCTTATCGTGTCTTCGGCGTGCTAAAACCTTTTGTATTATTGTGTATATTACAGGTTTGAAGTCTATTGTGGAAAGCAACAAATGCAAGACAGT
AGCACACCCAGTGATGAAAAATCGGGACCTGCCGCAGTCGTACGGAGCTTACGTCAAGTCTTCGGCGTCAACGGACCAACTGAGCGACGTCTCATAGTCA
CCGACAGGTTTTACACCTCTGTCGTGCTGGCTATGCAGCTGCTGACCATGAACTTCTACAGTTTGGGAACAATAATGACGAACAGAAAGGGGCTGTGCAA
GCAATTCTACCAAAGAAGACTAAAAACGGCAGGAAGGAATCAAAGAAGCGACCAGCACACATCGTCAAAGGAACGTATGACGTAGCCACCCTCCAAAAGG
TGCCATCGATCAAGGCCGTCCGTTGGGTGGATAATCAAGCGGTGTATCTGCTTGCTGCTGGAGGAAGTGCAGTACCAGACCGTATCGTGCGTAGGAATCC
AGTAGCTGGAGATCAGACAGAGTTGATGTGTCCACGGATCGTTAAAGACTATCAGACTTTCATGGGCGGAGTCGACGTTCACGACCAGTTACGTCTACAA
CGGCAAGTATTCATATCCTGTATATACACGTTGAAGTCATCGTTTTAACATGTATTGTACGTATTATTAGGTATTCACTGCAATTGGCTCGGCGCTACAA
GAAGTACTACAAATCTCTCTTTCTGGGACTGATAGACATGGCTATCATCAATGCTTTCATCGTGCACAATTACCATCGCGCGGCAACCGGGAAGCCAAGG
GTTTCCCACGTGACTTTTCTGAAGACGCTTCATCTACAGCTCTGTCAGTTGCTACCGGAAGATTGGGTGCAGCTTCTTCGCCCCGCGGGCATCACGCGAC
GCCAACGCGGGCACGACAAGCTCGAGCGGCGCACATGCCTGTACAGGCCGACGAGTGGCGCAAAGGAAACTCCGATAAGACGAGAAAGCGTAGGCAGCGT
GCGTGCAAGGTTTGTTCGGTGCTAAAAGGCGCTGCCACGTCTCGAGGAGGGGAAACGACATTCTACTGTGCTGAATGTAAGCTGAAAACAACATCAAGAC
ACGAGTTAACCGCACGCGTATTCCTCTGCAACAAGGTGAAGCATTGCAGCAAAGGCGAACCTACTTCGTGCTGGGATATCTGGCAGAAACACTGGAAAAA
TGGGACTATGATCCCTCAATCAGGACGCAAGCGCAAAATTCGAGCCCGGACGCCCGCACGCGCTGCAAGTGACGGTGGCTCTGATGCCAGCGACTCGGAG
TCGCAGTCTAGAGCTGAAATCGGAAGTGTTTCCTCTCAGGGTCGTTCGGGATGGCGGCCACACACCAACGATGACGGCATCTAGTGAGATCGTCGTCAGA
GCACATGTTCCGGCTTCAAAAATAACTTGATTTGAATATATGTTTTTTTGTGCAGATCGCCATGTGGAATCCTTCTCTAAATATCGACAAAATTATGACC
CGTCACTCCCCGCTAGATGTGTTTTTGTACAAATGTTGTGTTGTCTTTGTTCACTCAGGACACGATATCAGCGTTATCGCGTACAGTGCAGACATGTTAG
TATACCTGATACACGATATCGAGAAATGAAGACCCTAGGGGTGGGGCGCTGTACCGACTCTGTTAAATACACGATAAAATATAGCTGGGTCTTACTATTG
TAACCCACTATCCATAACGTGTATGGGGTTTCGGTAAATAGGCGCAACGAAATCCGCTCGCTTTGGGGGGGTTAAAACGAGTTTGAGTGTATTCATTTCC
AGAGCTATTCGGAAATATTCTTTTCTGGTCTAGAATGCTTTGACGAAATAGGAAAACAAATAGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTG
GAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGC
CTTGCGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTGAGAGCCCCTAGGGTGTAACCGA
CCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACC
AACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACAGCCAATGTAGTTCCGGTTCTTTAGGGCAGGAAGGCACTTGCGTGTCACTGTGCAAATT
GAGGTCTGTATTGATATTTAAGCCTATACCTGCCTGGATTTCTACCTTCTATGTCTTTCACTTGTTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTTC
TTCCCTTGACCCATCATCCCAGCTGTGTTATCTTCAGGTCCACCGGATCCATGACGTAATCATCATGGTCACCCTATTATGGGTACACTCATCCGGATCC
AGGTCGCTTGGATCCACCTCACTGTAATTGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCGTCTGTGATCTCCATTGT
CGCACGAAAGTTCGAGATCCACTGCATCCATCATCCCTATACCCTGGATCCAGGTCCCTCTACACGGGATCCTCCCTCCTTGGATCCGAACTCGGAAGTA
TGGGATCCGGGGTACCTCGCGGTGGATCCTGACTTCTTGTTAGCCGTGGCTACTAGATCCACCTTCAGATGGCACCTACCACCATTCCTTCATAGGATCC
ACACTCGATCCACTGGTACATAGCATATCCCATATCCACCTAAGTGAATCCAGGTAAGGGTGGATCCGAGATAAGTCTTGGTGGATCTTGCCTTCCCGTA
CATCACTCATACCAGATCCATCGTCATTTCGTACGGGGTGCTGCTCGTCATGGCTAATCCACCACAGGCAACTTGCACCCGTGCCAAACAACCCAAATCC
TCTCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTATTTCTGAGAAAGCACTTCACCACAATCGCCTCCTGT
ACGTTGTCGGCGCTGCACAACAGCGTTCACGACGTGCACTACCAGCATCCACAACCGCCTTCTCCCCTTTGTGACACATGTCTCCCACCAAGCGTACCAG
CCAATCGCCGGGCAAGGCTCCTTCTACCACTCCTCCGGTCAGCCCCTCTTCAATATCGCCCACCGATCTGCGTACTCTGGCCCAAGCTCTTTCCGATCGG
GTGCAAACCTTGACGGCGGAGCTCCAGACGGCCCAAGATGTTAGCGACCAAGCTGCGTCTTTGCACGCCACCCAACCCCAAATCTTGCGAGCCCAGGTCC
ATGACCAGGCTATGGAGATCCAGGGGTGAGAGCACCGTGCGGCCTCTCGATCGCAGGACCTACGACTCTTGTTGGCTGATCAAGCGGTCGAGATCCGCGA
CCTGACCGGACGGCTGGATCGCGCCTCCCGTCAACGAGATGGCATGCGAGATGACAACGACCATATTTTT