Description :
From Genome Similarity Track
Location :
Scaffold_1976:3086- 5828
Transcript NameFunction/comments
Phyta_totarag13950hypothetical protein

Sequence
2742 bases(100 bases per row)
ACCATTCCTCCTGATCTGCGACCTCCTCGCAGATCCTTCACCCAACCACTCACAAAGTGACTAGCTCACTTCATGATCCTACCGCCTTATTGTTCCTCGT
GCGACTGCATGGCCTCAAACTGGTTCCGGTTGGCCTGTTCGCGCAGGTAGTCGTGCAATACAGCTCCACAGTTGAGATCGGCTTCATCCACCCATGTTGG
TTCCGGGTAGCCCTTCCAATGCACCAGAAATTCCCGTAACGCTCGTCCGTAACGTGTTCGCCGTTCAGATCGCATTTCGATGATGCGTTCGACCTCGTAc
tcgtcatcatcaagcTCCGTTTCCAACTATCTTCAGGCAGTAAGGCTTCATCAAAATCAagtcgatcttgatcttaGACAGCTAGCCGAAGATGCGGACG
GTCCGGGAAGTCTCGCGCGGGCTTAAGCTTCGATACGTGAATCACGGGAAAGAGGTTGTACGTCGTGCCCGCGATCTCCAGTCACACGGCGtgctcgtcg
atcttctcgaccACTCTGAATGGTCTGTGCCACATGTGCGCTAGCTTCTGTGTGTAACCCTCCTTCACTCTGTCCAGGTGTAACCAAACCTGGCTGCCGA
CTTCGATCTCGTGCGGGCGCACGGAATCGTTATGGCGAGTGGCCCTGGTCTTGATAGCTTCACGCAGGTACTCGTTCACTTGCTCACACGCCTGTTGGTA
TATGGTATCGCCACCTTCGAGGGTCGCGATCTCGGCGCCGCGTCGATCCTAACGGGATCATCGCTTCCAGCGTTGATCTTGGGTCCCATCCATGCGCCAA
ATAGAAAGGCGTGTCGCCGCGCACTCGATCGTGAGCCGTGTTAAGGGAAACCGTGAGGCGCTCTGCGTACTCGTCCCAATTCTTCTGGTCGACGTCTGCA
CCATCCGTTCAGCCGTACCGTTCGCTTGCGGTCGAATCGCCATAGTcgctcgttgtcgttgtccgatgatcttcttgaacgATCTGAAAAAGTCAGACAT
GAAGCCTGGCTCTCGATCGTGCCGGATTGCTTCGCTTGCACCGAATCGTCGGAAAACACATTCTTCGTAATTCTCCGCAATCGTTTGAGCAGTTCTTGAT
GCACTTCCTTGGCGATCACGAAGCCGGTGAAGAGATCGACCCAGATCAAAAATTCCGTGTTGCCCTATAAGATCGGGGCAGCGACGGGACGTGGTCCATA
GCGATGATCTGAAATGGGTACGTCGCTTGCAGGTTGCCTGGCGAGTCACCTCGAACAGTTGGTTTTCCTTTTCCAGTTTCGCAATCTATGCACTGACCCA
CGTAACGTTGCACACCTTGATACAGTCCCCTCCAGTGGAAATGTGCTTTGATCCGCTGGTATGTCCTCCCGATTCATTGATGCCCATCGTCCAGGCTGAC
ATGGTAATGGTGTAGGAagtcttcttgcagcgtctCAGGAATCACCAGTCGAGCAACGAGATCGCGATCTTCATTCGATTGCTTGGACGCCGGGCAGTAA
AACAACAAGTCGGACTCGTCGATCTCATAATCTTCCGCAATCTTAGCGCAGGTCTTCGCCTCTAAAGAGGTAAGTTCCTGTACGTCTCCACGCAAATACT
GCTTGAGATCGACGATCcacttttcttcgtcttgtgcCAGGCAAATTCACTCTTCCCTCATTCGTTGAACAATCTCCTCCTATAACACTTCTGGGCTGCG
TCGCTTGCGCGATCTCGTTACGACCGTGATTTTGGTCACAGGACTATTAGATCGTGGGATCAGCATCTCGTCAAGACGGTTACGCGTCATCAGGTCTTGG
AACTCTTTCTCCGACGTCACTACCATACCTCCTTCACGCTGAAGAGCGGCGCCGGCGAGTCGACCTGCGCTTTGGTTCCAGTTTCGCTTCATATGAAGGA
ATTCGTGACTTGGCCACGATCTTAAATATTCCATAGCTTGTTGGCGTAGTAATTTTAGCCCAGGTGCCTTGCACTCGATCTCACCTCGCATCTGTCGGAT
GACCTAATTCGAACCTCTGCAGATAATTAGTCGTCCCCTGTCCAGGTCGGCCAGAAGATCGAAGCATAGGAGCAAACCGTGATATTCCGCCTCGTTGACT
GTCAAATCGTCCTTGTACTGCGACGCCGCTGAGATCACTTCCCATTCTGGTAGGCTCCACACAATAGCGCCATAcgctcctccacctcgctTTACTCGAG
CTGATCCATCGAAGCTGACCACTAGCAACTTTTCATCCGCCTCCACCGTAGGTGGCGGTATGGTAATTACCTGTCGGGGCTGTTTCCTGGGTGCTATCGA
AACTAAGATCGCGTCGATCTCTTCACGTGGCGTGATGCTCGCAGCCATTACGCCCAGGGTCTCGTCCTTACCTTTGTCGCACCTGACGATCTCCAGGGTC
CagctcgacagcagcgcggcCCAGCGGCCGAGTCGTCTTTGCAATCCTGACGAGTGCACTAGCCACGACAACGTGGAGTGTCGAGTCAGCACCTTGACCG
ATCTCGTCACTAGCTGCGTATAGCAGACATCCCAAATCctgagcagcgcgagaaccTCTTTATAGACGATCCGTAATTGATCTTGTCAGGCTTGAGCGTC
CGGCTAGTAAACGCCACCGGTTTATATACGCCCCCATGCTCGTGCATCAACGCGGCCGCAATAGCCCACTTGCTCGCATataccaccaccaccggtcttc
gatctggatcgaagtgctgcaagatTGGTGCTGTAGCGATCT