Description :
From Genome Similarity Track
Location :
contig_16:30848- 33822
Transcript NameFunction/comments
g4381.t1OWZ24639.1 hypothetical protein PHMEG_000245 [Phytophthora megakarya
g4382.t1hypothetical protein

Sequence
2974 bases(100 bases per row)
CTTCCTGCCCTTGATATAGAGCTCGTCCGCTTCCTGGATGGATAGCAGGTGCGCCTGGTGCTGCAGCGTCTGGTGCTTGAGCGACGGCCCCGAGTCGCCC
AGATACCACGGCCGTTTGCTGATGAACTCGGGGTTGTGCGGGTTGATGAGGTTGCCGCCCGCATCCTGCTCGGGCGGCAGCGTACCGTTCTTACGCGCTT
CCTCGATCTCTTGCTTCTTCTTAAAGTCGCTGCTCGACAAGCGCTCTCCACCGGCCGACGCCATCTCCGCTGGTCCTGCTGCTTCCCCTTTTTGTATTGG
AACCCGCCACTTCGTTTCCGATTGGCTGAAGCAAAATATTTCAACCAATCGAATGCCGTTTGACCAGTGCTCAGATTATCTCCACATGCGAATTTGCGTC
GAAGAGGGAGAACGAGAGTGATTGTCACGTTCCACCGGCGATGATCTCGGAGGCGGCGCACGCCGAGTGCGTGCGGCTGCTGGAGCTGCTGACGAACCCG
CGCGTGCAGGAGAGTTGGTCGTGGGTGTTCATGACGCCCGTGGAGATCCCTGGCTACGAGCGGGTGATCAAGCGCCCCATGGACCTGGGCACCATCAAGA
AGAATTTGGGCGTCAAGCCGTCGCGCTGCCGCTTCAAGTCGCACGAGAAGTTCGCGAGGGACGTTCGACTAGTCTTCCAAAACGCGCTAGTTTATAACAA
GGCCGACCAGGACGTCAAAGGGTCCGTTTACGCGGCGGCGCAGCATCTGCTGCGGGTCTTCGAGACGGCCTACGCCAAGGCCATCGAGAGCGTCTTCAAG
GCGGACGATGAGGCCAAAGCGGCCCACCGAGAGGCTAAGAGGAAGGCCGACGGAGACGCAGAAGGTGCGGGCTCCTCCTCCTCCTCCTCGCATCATCACA
ACAGCCATCACAGCAGTAACAGTCACCGTCGAGAAGAAGGCGAGGAAGGCAGCAAGCACAGACACAAGCACAGCAAGAAGGAGAAAAAGTCTAAAAAGTC
CAAGAAGAAGAGCAAGGACAGAGAGCACAGGCACTCGAGCTCCACCAGTGGCGAGAGCAAGAAGAAATCTCACCGCAGTGAGCACGAGAGCGGTGGCGTG
TCTTCCAGTGATCTATTAACAAAGGAGACATCCAAGACTGTCGTGGCGGCCCCTAAGAGCGAGTCGTCCATGCCGACAGCTAGTTATGCAGCTATTCCAC
AGAGTAATAGTGTGGTTGTGAAGCGAGAGGTGGTGCAGAGCCTCTTGGCTCCTGGAGAAAAGATGTCGGACGCGGAGGTGACAGAATGCCTTTCGCTGTT
GATGAAACTGGTCAAGTATAAGGAAGGAGCAATCAGTCCTGCTGCGCCGTTCCTACAGCCAGTGGACCTGACGCATTTCCCGGACTACCGCGTCAAAGTT
CCGAACCGAATGCACCTGTATGGCGTCCAGAAGAAACTTCGTAGCGGGAGTTACGGTACCATTGATGCGTTTGCCTACGACATGCGGTTAATTTTTTCGA
ACTGCCTGGTGTACAACAGCGACGTGATTCTGAGCAAAGTGATGCGGAATCATGCCGTCACCCTTATGAAGCTCTTCGAGACCCAATTTGCTAAGATTGG
CGGCACATGGCCAGGTATTTCAGAACGGTGGAAATGCCACCAGATCATCCATGAAATCCTTGCTCACCGCACGGATGGGCAGGAAACAGCGCAGTGGTTC
AAATATCCAATTGAGTCGTACTATGATTCACCGGACCAAATTCCGTACAACTACTACAAAACGGTCAAGGATCCAATGGATATCGGCACAGTGTCGAGTA
AGCTACATCTGGGGGAGTACAAGCACGTCTCAGAATTTACGGCGGGCATGAAATTGGTTTTTGACAACTGCATCCGGTACTGGAGGCCAGATCCCCAGGG
ACAGACGTACTGTGAGTCTGCGGAAACTTTGCTTCGCGTTTTGCACACACGAAGCGCTATATTTGCTTCTTCCGTAAGCAGTTCTTCGTCAAGAGAAAAA
CAACGATCCTTTTCGTCATCGTCGTCGAAGGTCAAGTCTGCCCCTGCTGCTACACACTCTTCCACTACACAACTGTCATCAGTTTCCGTGGCTAGTACAT
CTGGAGGGGAGCATGAGAAGATCAAGAAGAAGTCGTCGTCGTCGAAGTCATCCAAATCGTCAAAGCCATCAAAGACTCGGGAGGCCAGCGGAGGTTTGCC
GGAAAAAGATATCTGCTTGGGTATAATGAAGCAGCTGCGAGGGCACAAGATGAAGGGTTTCCGTGGAATCGAAATCAAAACGGCTGGGCCCTTTTTGACT
GCTGTCGATACAACCAAGTACCCGGATTACCTGACAATTGTCTCGGAGCCCATGGATTTCGCTAAAATCGAGCGCAAATTGAAAAGCGATCGGTACGGCA
GTGTCGACGAGTTCAGTGCCGACGTCCACTTGATATTCTCGAATTGTCACAAGTACAACAGTGACCCGGTGGAAGGCGCCGACATCCGAGCGATGGCCAC
AAACCTGCGCAATTACTTTGTAGAGCTTTGCAACGAGAAGCTGGGTCCTTTGGACGGCATGGTAAATGGGCCGATTCAAACGCCAACCCACTCAGCCCAG
GTCGCGTCAGCATCATCGTCTCTTGGTGTAACTCAACCCAAACCAGTGGCCCCAACATTAACGCGTGCGCCCGAAGCTAAAGTGCATAGTGCTGGAACGG
GGTCTTTATCTCTCCACAAGCCAATGAAAAAATCCCCCGTCCCCTCTCCGACCAAGAGACCGGTGTCGTCTGCATCTGCGGCCGTGTCCAGTAGTGCTGT
CTCCTCTCGTGACCTGAAAAGGGAAATGGAATCGTCTCGCAGTAGGGACTCCCTGAAGACAGAGCCTGTGGGCGCTTCAATAGCAATTCCAGTCGCTTCG
CTGAAGCCCGTTGGTCAAGTGAAGGCAGTGCCTGTGCCAGTCGCCGCAGTCTCTTCATCTACGATGAGTAAAGA