Description :
From Genome Similarity Track
Location :
contig_16:30835- 33810
Transcript NameFunction/comments
g4186.t1OWZ24639.1 hypothetical protein PHMEG_000245 [Phytophthora megakarya
g4187.t1OWZ24657.1 hypothetical protein PHMEG_000267 [Phytophthora megakarya

Sequence
2975 bases(100 bases per row)
CGGTGGTTGTGAGCTGCTTCCTGCCCTTGATATAGAGCTCGTCCGCTTCCTGGATGGATAGCAGGTGCGCCTGGTGCTGCAGCGTCTGGTGCTTGAGCGA
CGGCCCCGAGTCGCCCAGATACCACGGCCGTTTGCTGATGAACTCGGGGTTGTGCGGGTTGATGAGGTTGCCGCCCGCATCCTGCTCGGGCGGCAGCGTA
CCGTTCTTACGCGCTTCCTCGATCTCTTGCTTCTTCTTAAAGTCGCTGCTCGACAAGCGCTCTCCACCGGCCGACGCCATCTCCGCTGGTCCTGCTGCTT
CCCCTTTTTGTATTGGAACCCGCCACTTCGTTTCCGATTGGCTGAAGCAAAATATTTCAACCAATCGAATGCCGTTTGACCAGTGCTCAGATTATCTCCA
CATGCGAATTTGCGTCGAAGAGGGAGAACGAGAGTGATTGTCACGTTCCACCGGCGATGATCTCGGAGGCGGCGCACGCCGAGTGCGTGCGGCTGCTGGA
GCTGCTGACGAACCCGCGCGTGCAGGAGAGTTGGTCGTGGGTGTTCATGACGCCCGTGGAGATCCCTGGCTACGAGCGGGTGATCAAGCGCCCCATGGAC
CTGGGCACCATCAAGAAGAATTTGGGCGTCAAGCCGTCGCGCTGCCGCTTCAAGTCGCACGAGAAGTTCGCGAGGGACGTTCGACTAGTCTTCCAAAACG
CGCTAGTTTATAACAAGGCCGACCAGGACGTCAAAGGGTCCGTTTACGCGGCGGCGCAGCATCTGCTGCGGGTCTTCGAGACGGCCTACGCCAAGGCCAT
CGAGAGCGTCTTCAAGGCGGACGATGAGGCCAAAGCGGCCCACCGAGAGGCTAAGAGGAAGGCCGACGGAGACGCAGAAGGTGCGGGCTCCTCCTCCTCC
TCCTCGCATCATCACAACAGCCATCACAGCAGTAACAGTCACCGTCGAGAAGAAGGCGAGGAAGGCAGCAAGCACAGACACAAGCACAGCAAGAAGGAGA
AAAAGTCTAAAAAGTCCAAGAAGAAGAGCAAGGACAGAGAGCACAGGCACTCGAGCTCCACCAGTGGCGAGAGCAAGAAGAAATCTCACCGCAGTGAGCA
CGAGAGCGGTGGCGTGTCTTCCAGTGATCTATTAACAAAGGAGACATCCAAGACTGTCGTGGCGGCCCCTAAGAGCGAGTCGTCCATGCCGACAGCTAGT
TATGCAGCTATTCCACAGAGTAATAGTGTGGTTGTGAAGCGAGAGGTGGTGCAGAGCCTCTTGGCTCCTGGAGAAAAGATGTCGGACGCGGAGGTGACAG
AATGCCTTTCGCTGTTGATGAAACTGGTCAAGTATAAGGAAGGAGCAATCAGTCCTGCTGCGCCGTTCCTACAGCCAGTGGACCTGACGCATTTCCCGGA
CTACCGCGTCAAAGTTCCGAACCGAATGCACCTGTATGGCGTCCAGAAGAAACTTCGTAGCGGGAGTTACGGTACCATTGATGCGTTTGCCTACGACATG
CGGTTAATTTTTTCGAACTGCCTGGTGTACAACAGCGACGTGATTCTGAGCAAAGTGATGCGGAATCATGCCGTCACCCTTATGAAGCTCTTCGAGACCC
AATTTGCTAAGATTGGCGGCACATGGCCAGGTATTTCAGAACGGTGGAAATGCCACCAGATCATCCATGAAATCCTTGCTCACCGCACGGATGGGCAGGA
AACAGCGCAGTGGTTCAAATATCCAATTGAGTCGTACTATGATTCACCGGACCAAATTCCGTACAACTACTACAAAACGGTCAAGGATCCAATGGATATC
GGCACAGTGTCGAGTAAGCTACATCTGGGGGAGTACAAGCACGTCTCAGAATTTACGGCGGGCATGAAATTGGTTTTTGACAACTGCATCCGGTACTGGA
GGCCAGATCCCCAGGGACAGACGTACTGTGAGTCTGCGGAAACTTTGCTTCGCGTTTTGCACACACGAAGCGCTATATTTGCTTCTTCCGTAAGCAGTTC
TTCGTCAAGAGAAAAACAACGATCCTTTTCGTCATCGTCGTCGAAGGTCAAGTCTGCCCCTGCTGCTACACACTCTTCCACTACACAACTGTCATCAGTT
TCCGTGGCTAGTACATCTGGAGGGGAGCATGAGAAGATCAAGAAGAAGTCGTCGTCGTCGAAGTCATCCAAATCGTCAAAGCCATCAAAGACTCGGGAGG
CCAGCGGAGGTTTGCCGGAAAAAGATATCTGCTTGGGTATAATGAAGCAGCTGCGAGGGCACAAGATGAAGGGTTTCCGTGGAATCGAAATCAAAACGGC
TGGGCCCTTTTTGACTGCTGTCGATACAACCAAGTACCCGGATTACCTGACAATTGTCTCGGAGCCCATGGATTTCGCTAAAATCGAGCGCAAATTGAAA
AGCGATCGGTACGGCAGTGTCGACGAGTTCAGTGCCGACGTCCACTTGATATTCTCGAATTGTCACAAGTACAACAGTGACCCGGTGGAAGGCGCCGACA
TCCGAGCGATGGCCACAAACCTGCGCAATTACTTTGTAGAGCTTTGCAACGAGAAGCTGGGTCCTTTGGACGGCATGGTAAATGGGCCGATTCAAACGCC
AACCCACTCAGCCCAGGTCGCGTCAGCATCATCGTCTCTTGGTGTAACTCAACCCAAACCAGTGGCCCCAACATTAACGCGTGCGCCCGAAGCTAAAGTG
CATAGTGCTGGAACGGGGTCTTTATCTCTCCACAAGCCAATGAAAAAATCCCCCGTCCCCTCTCCGACCAAGAGACCGGTGTCGTCTGCATCTGCGGCCG
TGTCCAGTAGTGCTGTCTCCTCTCGTGACCTGAAAAGGGAAATGGAATCGTCTCGCAGTAGGGACTCCCTGAAGACAGAGCCTGTGGGCGCTTCAATAGC
AATTCCAGTCGCTTCGCTGAAGCCCGTTGGTCAAGTGAAGGCAGTGCCTGTGCCAGTCGCCGCAGTCTCTTCATC