Description :
From Genome Similarity Track
Location :
Scaffold_77:3083- 10195
Transcript NameFunction/comments
Phyke_g3237hypothetical protein
Phyke_g3238hypothetical protein PHYSODRAFT_492444

Sequence
7112 bases(100 bases per row)
GTCCTCATCGCCCTTCCGGAAGAACGCCACAAGATCAGCGAACACGTCGAAACTCACCTGCAATAGAAACAAAAACACTCGGTGTCAAAGACTACATTGT
CCCATGTGGCAGATACATCTACGCCAGCACATACGTTGAACGGATGGGGGACCTTGAACCCGACAAGTGCTGCCGTGATCTCGCCAGTCGTCACGCCAAT
ACCCAACGCGTTCACCACCCCCAGTCGTGCTGATACATCAGGAGCAAAGCATAACACAAACCCACACAAAAGTTTTAAGAGCCTCGACCATCACTGATAC
GCCAGCACAAAAAAACATACTCTGTGCGACTGACAACAGCCCTCTGCTTTCTTTGTCAGCTTGAGAGAAAGAGGTCCAGAGCAACTCCATCGGGTCGTCC
ACCTCAACAGTCTCTCcaacgtcatcatcactcaAGTCAGAGTCGAATTGGCCGAACTCATCATCCGATTCGTGTTCATCGCCACCGTCTCGCCCCAGTG
GCTCATCATCCTCCTGAACTGTTTCCATGCGCAACCCGGGGCTCAATTCCTGTGAAGAAATCTTGGCTTTCATTTCACGCGCCTTCTGTCGAGCGAGCTT
TTTCCGCGCCCGAGTGGATTTGTAAGCTGCTAACACTTTCTTTTGCATTAACGTTTCTTGTGCTATTGCCTCCTGCTGTCGAGGATCCACAACCTTGTAG
CAATCCTTGTTTGTTTCGCGCTCTTTTTGCCACTGCTCCCATTTTTCCCAGCCTGTATACATTTCAGACAGCTCGTCTGGAGACAAAGGCTGGATTTGCT
CGATGCGCCTAACAGCCGTgaattgctgttgtgctAATGTGTGCCTTGATTCCGCGAAGCAGCTTGGCAGATACTTGGCCGCAGTTGCCACAGGCCGCTG
AAGAACTAGCATTTCTTCGTGCAGTGCTTCGTCGTTAAAGAGAGTGTTTTGTAGCTGAGATGAGCTCTTGGGCGGACTCAATTGGCGGTGGAACACATGG
TGCTGAATTGGATCCAGCTCGTGTAGCTCCCTCACGTGGTTATCAAACGCGCTGTCATCAACATATTCTGCAACATCCTGGGGCCTTAAGACCTCGATAC
CAGTTCCATCACCATTCAGAACGAACACATACGGCTGGATTGGCTCATTAATAACTGCTTGTGCTGGGATTTTATCCACGCCGTGTCGGGCAGCTTCTGA
CTCACTGACTACACCAGCTAAATCAACCGAAACTGTTGGAGGCAATTCGTCTGATCCACTCAAGTCCACATGAAATTGATTCTGTTCATTGTCACAAAGC
TCAAAACGACCATGACGGCAGTCGAAGTAGAAGACACCGTTGTGATTTATCACATCTctatcgtcgtcatccttgACGTCGGAGACAGCCCGATCCCCTG
CTGGCCGAATGGAATTGAATTCCACTCTCCCACTGTCCTTTGCCACGATTACTTGTCCGCTGGGTTTCCTCGTGGTGACCCGACCATTAACCTGCGCAGT
AACTTTTGTGTTATAGCTGATCTCAACACACGTTCCATCATATACGCTCACAATGCTGCGTACACGCAGACCGCCCTTTGTGACTGCTACACGCTCCCCT
GCAGCATGGCGCTGGGCTGCCACATTGACCTCCACATCGACGCAGACATCAGCGAGGCCTTGCTTCTTAACAAGGATATGGGAGCCACCAGAATTTAAGT
GCATCCGGGTGCCATCCACGTGATACGTTATGCGGGCACCGCTCGTAAGGGTGACAATAATGACGCCATTAGGACGTCTCTCTACCAGCGCATTCGTCTC
TGGATCCAGAGTAAGCGTAGTAGCTAATGGTGGCTGCAGTTCGATGTCATCAGTTCTCGAGCGATGGTGTCGTTCCCCACAATCACAAATCACACGAATA
ATGCCACTGGCAAGCATAACTTCCTTCCTTCCGCATCGAAGCACTCGTAGTACACTTCCTTTCCCATATACGACACGATATTTTTCTTCCTCACAGTCAT
AAGTGCAATACCCGTTTTTCAAACCAGACACGAGCGAAACGCCGGTACCATTTGCGCCATCGCCGACTTCGTGTTTATTCGGTGTACGAGCTGCAGATTT
GTTTGTTGGCATTAGTTGAGCGTACCTTTGAACAATTGATCCATCTGAGCAGGCAGACACAATAAGACCGCTCGGAAATGAGTTGGACACCGTTATGGTG
GAGAAACCATCGGGCTTTTTAGATAACTTTCCCCTCCCCGCTGAAATGTAAATATTCGAGTCGTCTTGAAAAGACCCGATGAAATGCACGTTGTGACTCC
AGTCAGTagaagaagatgaggctTGCTCGGTGATTTCTCTTGCATTGCCATGGGGTTCTTGTTTCTCGTTAAGATAATGCAGGTCCGCACGTAATCCAAA
AGTCTCCCTGTAAAAGCAAAAAGATTGGGCAGCGAAGTTTAACCATACTTACTATGCATACCATTGCACCAAGTTATGATATCAAGACGAGAATGTGCAC
GTACCCAAGGTGATATACGGTGAGCCACACTAACCCACGTGGGGTTTGGTATAGCCGTACAACACTGTGGTCGGCAGGGTACATTGTCCATGTCTGTCTC
GCCACGAGTGCGAGTTGCCCAGCAGACAATGGCACACatgcacctgctgcaacttccGTGCGTGGTGTGAGGTACGCGGAATCTGCAAGTTGCTCCATTT
TCCAGTCCTTGAACGCTGGCCGATGACGCACATAATCGCGAGCTTCCCAGAAAGACGATTGCATACGACCGGGTGCCGTCTTCGGTAGAtacgccagcag
cagtgagtCTGTTGGAGCATAATAGCTGGAGTACATGTCGGGCGTATTCTGTCGAAGAACCAGTGCAAGTCGCTGAGGCAGGGTAGCACAGGATAGCTTC
TCCAGAAATGCCCGCGACTGTAACTTTCCCCGCCACGAACTTCCCAGCGCACCTTCAACCTGTAAGAGCTGTCGTGTCAGGTGGACTATCCGGCTACTAA
AGCGCGGTGACTCATAGAATGAGGCAAGTTCTGTGTTGCATACACTGCGCTCCGGCTCAGTTAGCTCAGGCACCCGTGGCATTCCCTTCCGGCCTTCATT
GCCTACACCTGGTAGATCATTTCGCCTCCACATGGCTCGCTCCACGTCGTCAAGGCGGTATTTACCTCGGGAAAGATAGCATGGGTTTCCTTCGGCTTGT
AAGGCTTCCCGGCAAAGCTGTGCGCCCGCAATACGGCATGCTACTAGGTCTCCATGCTCCATGAATCCCTCGGAATCTGTACGATTGTGTTGGGTTGTAC
AATGTGGGTGAGAAGTCGTGTTTGAAGAAAGCAACGACATTGCAGCCACAGCCTCGGTGACCGCAAAGAGCACAGTGCCAACTGTGATACTGCCAGGAAA
GACATCGTCAAAAATGGATGCGTACTTTGCCCGCAGAAGGTTTGTagcgtcatcgtcatcaagGGTCGGAATGGCGCAGAACGTTGTCGATTGCACCCAG
GCTTTAAAAGCAAACTTCTGCGCTGCCGACGCTTCCACAGCGCCGAAAAGTTCGTTTTCAATTTCCTCAGACGTCCTAGTCGTTGCCCCATTTGCCCTGC
TGTTCACATGCGTAAAAGTAAAGTCGCTCCACTCGATTCCGCCCACTTGGGCTGCCTCATATAATGTCTTTGCAACAACATTGCAAGATTGAAACATCGA
TATTTCCTCCACTGACATGCTTGCCTTTGTCAAAGGAATCCTTGCGACAGACTCCCGCTGCACAGCCGTAGAATTATTTTTCAAGCGACCCCGCGAGGCT
AGTGGGTCTGCCAGAAGCACCACCCCGTCGATGAGTGGCAACAGTGGCAGTAATCCAGGACTATCAGTCACTTGGGATGCACAACCAATCTCTCCGAGCC
GAAGTAGAGCATTGATCTCCACGAGAGAAGCCGGATAGTCCAACAACAGATACACGCGGACGGGTGTTTGCTCACGGATTTGTTTACTCGAGCCtacagc
ttcctcctccactATACGAGGCTTCATCTGCCCAGCCTGATTCCCTGTCCcttcatccacttcaactgcagcatttgtgtGTCGAAATCTCATAAAGTCT
CGCTTGTCTTGACTCACAAGACGTTGGAAGGCCAACGCCAGTAGTGCCGGCGTGATGACAACTTTATCCTGTtcctccacagcttcacCTGCATCTACTG
CTCCTTCTACAGGGTCACTTTGCTCtccttccttctcttcttgtGCCTTTTCTTCACGTcgcttggcctccttctgctcctcaTGTGTCACGCGCACGAG
CTCCTGTAAGTCAGCGCGCCCCACAAGGCGATACGAGCACTTCTTCTCCCATTCTCCGAGTGTCGTGTCCGCCGTCAGCCGTGCCAGTAACTCTTTCTTG
GCGGCAGTCTCCTCGTCCGACGTTCCGCTCACCAGCGTCACAGAGTGGAAGCTCCAGGGCCGTCGCATGGCGGCTGTTGAAGTACAAGTTGTAGCTCTTA
GTCTGTCCGATTTCTATCGCCTCACACTAACTCGCTTCACATCAACTTGGGACAGATCACCGGACAGCCGATCAAAGTCACTACGCTTTAAGGATTCGAC
TGCATGCTGCTCCACGTGCTGCTTAATCTGTGTGCTCTCGCCTGGACGGCAACAGCCGCTCCATGCGACGAGTGGAGGCTGCAGCGTGATGCTTCGACGC
TTCTGGCGGCCCGCGTGGACATGGAGTTGGGCGGCGTGGCAGCAGGCAAGCGGGACGACGTGGGCTTCCAGTATCTCGTACGTCCTTGTTCCAGCTTTAC
CTCTTGCCTAATTGGCCCTTTAACTTACTGTATTGCTAACATGATGGATATGAATCACTTAGAAACCGGCAGAAGCTCTATTGGCAGCACAAGCCATCGC
CCACGAAGATTTCAACCAGGCGGCGGCCCAGGTCCAGCGCATTCTCCAGTACCAGAAGCCTGACGGGTTGTTACCGCACTTGATCTACGGTCCATCCGTA
CCTTCCAATTGGCGCTGGATTCCAAGCAATCGCACGTTCCATCCAGGCCCGGCATTCTGGCAACAGAAGATGACAGAACACGAGGGTAGTgagctgtcgt
cttcattAAACACCTCCACGATCTCGGCGCCGCCTGTAGCAGCAGATGTGGCCTGGGAGATCTTCCGCTTAGCTCCGTACGATTCAGCAATGGGCGTGCG
CACGACTGCAGTCCAGTTCTTGTGTCATGTCTACCAACCGCTGAAGAAACTGCAAAAGTACATGTTCTCCACAAGGCGTGGCGGTGCCCCTGGCAGTTTG
CTGGCAGTTCATGTAAGTCGTAGCTACGGTATTACCGTATCGTGCACTGTGTACCTGCTGAATGGCGGTCGTTGCAGCGGCTGATATGTTTATTGTGTGG
ATTTTTCGTGATGCAGCACCCTTGGGAGACATTCTCGTCGCTCTCGCCCCATTGGAAAGGATTTCTCGCACCTCTCAAAGAGGCCCCAGATTACCACGCA
ATCATTAGCAGTATACCCAAGGAAGCCCGGACACGCTTTGCGCTTGGTGCAGAGGCAATTTTCTCGGCAGAAGACGCTATGGAAAATGTATACGAGCCTA
TGATATACTTGGCAGTACAACAACACCGTGGGGGAAGCCACCGCGAATCGGACATGCTAAGCCCCATCTATTACCCTGCGACAAACAACGACGCTGTTCG
GCTTGGGGTGGAGGATGTGGAATTCAATGCTCTTATGCTACGATCCTCCCTAGGTCTCGTGAACATTGGGCGTGTGCTAATGGAGCACTCATCAGTGTGC
ACAGGGTTCGCACTAACCGAAAAGGAGCTTATGGATGATATGAAAGAGCTGCGTGCAATGTCCAGAGGACTAGAGGGAGCTCTCCTCGGAAACAACAAAA
CACGGGGCCTTTGGGATACTTCTGTTGATTTTTTCGCCGACTCCAGTTTATCATCGCTGACGGCAGTGCATTCCTTGCGAGGATTTTTACCAGGATACGC
TGTCGAGCTAGGCGATGATAAGAGAATGCGCTCGATGAAGCATTTTCTGCCGGAGCCCGACTCGTTTTCTTTCTTTTGCAGCCAGTTTCCAGCTTCGTTT
TTCCCCTGCTCCGACGATGCTGAATTCGGAACTGGTTCCGTGTCGGGCGATCGCCCAGTGACCACTACGTGGATACTTTACAACTACTTTCTGCAGCGGG
GGTTTTCGCGTGTACGTCTTATTGCTGATTTGTGTGTTCCATCTACTCCTCACCATACTAACGAAGTTTGCAATGATTTACGCCGCTTAGAACAAATTCC
CTGGACTGGCTGAGTACGTCCGCAACAAGACCAGGGACATGGTGTGCAATGCGACACCACCCACATCAAAGCCACCGTCTTGGTTTCCGTTCTCACTAAA
GCTCGAGAAGACTAGTCAAACTGCACTGGCACTAGCCTACAACTCGCACAATGCGTCCGCGCTCGATGTCTTTGACGACAGTTATTTGGGCTCAACACTG
GCTGCCGCCGTCCTGCTAAACattcttcttccagcaggtGTGCTGATTTGCGTTGGTGGTTCTCTCTCGCGTGTAGATCGCTAACACTTACTCGATGCTC
TTTCTTACAACAGTAACTCCGCCACCGAGTCCAGATACACCACCCATCGATCACCGCATACTCTCTGTCATCATGTGCGTCGAACTGGTAGTGGCGTTTG
GTGTCGCTATGAGCTGTTTTCTGTTTTCAGTATACTTCGTGGCAAATCGACCACGGGAAAGTCGTTCACCCCCTACATCTGCTGCCCGTCGACGATCCTC
TGGCGGTAAAAAGCTCGGAAGCAAGATGGACGGCCGTCGAGAGGATTTAGAAGACCGCGGACGATCCAGTGCTGGATCATCATGGGCAGACAGATACTCG
GAGTCCTCTTACAGTGACTACTCGCCTCGGTCTGGACACACACCTTATGACCTGGAGGAGTCATTGATTTCTGAGGAGGATGAACGCTACGGATCCTTCG
ACAACACCGAACACCAGCACGCCCCCTCTAATTCAGTGTGGAAAACTGCGAAAGATGCGCTAGCTGCCATCAGCCCCTGGTGATCACGCCCACCAGACAA
GATGTCGAGTTT