Description :
From Genome Similarity Track
Location :
Scaffold_415:308261- 311032
Transcript NameFunction/comments
Aphin_H310_06244ankyrin repeat protein
Aphin_H310_06245peptidase putative

Sequence
2771 bases(100 bases per row)
GTAGACGATATCGACGAAATCCTGGGCCAGGTCGCCGCCAAAGCCGATATCAATGGACTGGGATCGGACGGTCGCAATGCTCTCCATTGGGCCTGCGCGC
TCAACCGCACGACTGTCTTGCACATTCTCGTGAAAAAGGGGGCCAACATTAGTCAAAAAGATGTGCAGTCATCCCCCTTCGTTGTTGCAGCTGTGCGCTC
ATGCAGTGTGTGTAGAAAGATGGATGGACGCCATTGCACTGGGCGAGGTACTTTGCACCACCTTCCACGACCGTACGATGTCATGGCGCCACGTTAGTCG
CATGGGAAACCCCGATGTCGTGCGGCTCCTTGTCAAGCATGGTGCCGATGTGAACGCCAAAGATACGTGGGGCACGACGCCGTTGATGCTGACCGTGCTG
GGAAAGAGCAAGACCGCCGCCATGTGCCTCCTTGAGCTGGGTGCCAATATCAATGCACGAAACGTAATGACATGGCGCATGCATGGCAAGATTATGATGG
CAGGCTACGCTAGGTCTTTGGACAGACAGCGCTCATGCTGTGTGTGGAAGAAGACGCCGAAATGCACGCGTTCGTTGTCATGCTCCTCAACGCCGGCGCA
TCCCTCACGCTGCGCGATGTACGACCTCGACTCCATCGTGCGGTGACTGTCCAATGTCACCATATTCAACACATCCTTTTGGTTAGTTCCAAGGGATGTC
TGTGTTGCATTACGCTGCGAGCGCGGGACTCAAAAACATCGTGCATGTCCTTATTGAGTGTTGTTTGCCGGACCAGCTTGTCCAAGTGAACAAGGTGCGC
ATGGGCCAGAAGCGGTTGTCAAGTTGATAGCTGGGACATGTTAGTTTGGCGACACCCCGCTGGCCGAAGCTCGGCTACGAGGTCGTGCGAACACCGCGCT
ACTTCTCGAACGTGCGATCGAACCTGCAATGCTGCCACCAGAGTATGCCGCCAGCGACAACGGAGACGAACTGCCGAGGCCATCCTCCGACAACGACTCG
AGTGACGACGACACGTCGAACGAATGAGGACAACCGACTCTGGTCGCACACAATATCAAGTTCCAGTAAATAGTCCCGCTAGGCTAACTCTAATTTTTCC
AGCAACAGCATCGTTCCCTTTTGCTCCTTGTGCGCGGACGTCCACTTTTTGCCCTTGAGCGCCTTGACGAGGGCGGCGTTGGCCCCCGAAACTGGAGGGT
CCAGGAAGGCTAGAAGCACGAATGCGCCGCGGTTGGATTCGGCCCACTGAGCAATGCGACCTGCCTTGGTCAGTTCGGCGAGCAGGGCCGAGCCAACCGT
CGACGCGTGTTGAATCAAGCGCTGCATGTGTTTGTGCGCGATGAGGTCCGCATACAACATGTCGAGCGAGGTGTCGGCGGGGGTTTCGTCATGGACGACA
GTTTGGACAACCGCTTCCAAGAGGTCCGCGTTGGTGGACTGCTTGAGGACTTCAAACAAAACGTGGCCGCCGCTCTTGGAGCGGAGCAACGCATCGACAT
TCTCGGCGCACATGGCCTCGATGGGGGCCTTGAGACCAGCCCACAGTTCCTTGCGGCGGGTCTCGGGGTCCTTTTTGTAGTTGACAACGAGCTCCGTCGA
GCCGACGGCAGCAGGGACCATGGGCGGCTGCAGCAGGGCGATTTCGTCCGGGTGGAGGTACTTGGTGTTGAGGGGCGATAGCAACTGGAGGAGAACTTTG
CTTCCGTTTTGGTGCAGCGCCACGTCGAGCCAGTGGTCTTGCAATTCGGACAAGACTGACTTTTGCACGAGCACCGTGTCGTCCAACACATCCAGCACGC
GGAGCAGGACGAGGTACCCGCTGATGTGGTTGCATGCCTCTAGTACCTTGTCCTTGAGGGTCTTGATCACGCGCTTGCGATCTTTCGCGTTTCCGAGCGA
CAGGCACACCACGACAACCTTGGCGCCGGCCCGGGTCGCCAGGAGCGCCACCGCCGCGTCGCGGATGTTCGGGATCATGGCGTTGACTTGGTCAGTCGAC
GCCACCGTCAAGTACTCGAGCATGAGCGCCTGGACGAACGCCAACCCAAGCAACTGCTTGTCCACCATGCGGTTGAGCACATCCGCAACGTGCGTGAGGA
TTTCTTCCTTCTTGGACGGGCTCTGCGCCACGATGTCGGCTAAGTTCTTCTTCTTCGACTCCATTTCCGATTTGAAGTACGCAAACTCTTTGCCGTAAAA
TTCGAGCTTGAGGCCGCTCAGTTGCCCGGGCTGCAAAAAGTCTTGCGCAGACTCGAGGATTGTCGCGGCGACGTTGTGCGTGGCAATCTTGACCACGTTT
CCCGTGAGCTCCTTCACAATCAGCGCCCGGTCCTCCTTTGACCCGTACTTGATCATCTTGGTCACGAGAAAGCACCCGTATTGCAACTTGGCCATTTCAA
GCATGTGCGGGAGCATTTCCTTGATCGCGCTGCTCCGGTGCGCAGGGGTGCCGTACTTTAGGAGCGACTGGATCACGCGAGACGCATCATGCTTCGCCGC
CACGTCGTGAATCTTGCCAGTCACCAAGTGAAACAGTTCATCCACGAGAGGCACTCGCTTGGCCTTGTCCAAGTCGCGCTCGCGGATGATGTTCCAAATT
TCCTTGGCGCGCTTCACCATGTCATAATTCGGCCGACTCATCTTGCGCTGCAATTTGTAGTCCACTGGAGCGTTTTTCTCACCCTTTCCTTGATAGCCGC
CTTTCTTAGCTCCGTCCTTGCCCTGCCATGACTTCTTCTCGCCAGGTTTGCCTTGCAATGGCTTTTTGTCT