Description :
From Genome Similarity Track
Location :
scaffold_50:30826- 33699
Sequence
2873 bases(100 bases per row)
TGGTGTACCCCGTTACAAGTTGCGCTTGAAACGGATGAAACTACTTAGGATAGGAAGGAGCGAGGTTGGGCAGCCCAGCTGAGCTCAGTTTTAGTTTTTC
TTCTTCTCGACACACCACACTACACCCCGAGAATGCGATGAATAAAAATCTACTTACCCCACGACCTCACGATCACTGAAAACAGCAATCTACCTCGCAC
AGATAATACAGATGTGCATGGGATTTGAAACCGGCCGGGATGGGATGTACTGAGGTAGATGTAACGTGAAGGGGAAATGTCACAATGCGGGAAGCTTCCA
GCATCTGAAAACAATAAATTCAGAGTAACTCAGCACTATTGCATCTACATGTATATGGCACCTGTGCTAATCGTGCAACCTCGCAGTCTTTATTGGTCTG
ACCTTTGCAGATTTGCCGGGGACATCGGTACATGTATTTCAGGAAATGGGCTCAAACTTAATAAAGAGGCCACACTTATATGCAGGTATCCACTATAAGC
CGAGGAAATCGGTATTGGCGTCGAAACAGTTCTACTACTGTACTACCGCCACTTCTACAATACCCAACGTGTGCTTAAGCGATGTTTCCAGCTGCGTCGG
CTTTCTTGATGTACCGCATTTCATCAGCGGTTACCACACCACTGAGAATTTTGGAAAGTACTGCCGGGGTTTCCTTATCACGCATCCACTTATCGAGCAG
CGCGTTCACTAAGTTCGTGGCCAGTTTCTCCGTACTCGGGACCTTCCTCGCCGCATCGAACATCCTCAAAAGATCTCGCTCAGCGTAACTGGCTAGCAAG
CCATCGATCATAGTCGTTTTCTTGTCGGGATACCGCTGGTTGAAGTCACTCAGATACTTGGCCCAGGTTTCGAAACGTGGATCGGTAAAAACCTTTGCGT
CTGCCGTGGGCTGTCGTAGAATCCAGTTGAAAGTAGCACTTGGAGGCTTCTCCATGACAAGCCAACGTTTCAGCTGTCCTGCCTGCACCTTTTCAGCAAT
TTTCAGAGTGCTTGGATTTTGCAACCCCTTGTTAGCCATCGATTCAACACCTCCATCACCGTAGGCCGCATGAAGTGAAACGTACCAATCGGTTTTTGCT
GGATTCCCCTGGTCGAACGTTTTCACGTAGGTGAGCCACGTCTTGAACAGTGGATTGCCAATAACATTGTCCCATGCATCGCCGAGTCCAAGTAGCTTGA
AGACTTCATCGGGAGATTTGTTGCTGGCGAGATAGCTCTGGATCTGATAAGTATATAGTATTGTCCTTTCGGAATACTGCGAATTTTAGTGTAGTTGATG
TATTAGTTGTTTTAGTACGGAAGCCTTAAATGACTAAACGCTGCCCAGCGTAGTACAAGTATAGTAATCTTTGTCTTCGCGAACGCCTTTTACATATAAA
GAACGCAAGTATATCTGGTATAAAATCCAACCGATGGTCTGTCCCTTCCAAATGAAACAAGAGTTTTGAAAGTTTTTTAGGCTTGGGTCATTTGTTGAGG
AAGTAGATCACTGTAACAAGCGGATAGTTGCCAGCACCGGTACCCTCGACCACATTAATATCTTGGAATCTGTAACTGTCCCATAATCAATTGTCCCCAA
TGAAGACACTTCATGGCATTTCACCGTCGTTGTCCGTACTTGAATCCTGGTAGACAGATGGAGATGAACTTTTAGGATCGACCAGTAGCAAACAACGGAA
ATTGTCCCTGATCACTCGTTCACCCCATCCGCGATACCGTGCGCGCCAAATCGATAGGACCCCGAATTTCGGAGCAGATCGTTGCCGATAACTCGGCTTC
TACTGCGAATTAGAGACTGCTATTTAGATATGTTGCTGCTTTCATGCATACCAAGAGCAGGCTTGCGCTAGCAACTGCGAATTCGACACCCTTGGCAGGG
CTGGTATACAGATTGCAGGTTTTGACAAGAGCGACAAAATATAGTACCATATCCTTTTCTGGCGAAACCTACACGTTTTATGCGACTTCATACAAACTTC
TATATTAAAAGAATGAATGTCACTACTGGTCAGATGAATGGAGGAAACTTGTTGTTGAGCAGCTCACTGCTGCTTTAATCGTGGTTGCCAGCCTCTCATT
TTTCAATGGGCCGTGGTAAAGCCCTCACCAACCAAGAGTATTGGTGGATCATCGGGCTCCACGACGGCGGGGTCTCGCTACACGACATCTCAAGAAAAAC
CGGCCGCTCTCGCACCTGTGTGCGGAGGGCTATCAAGACCGAGCGAGGACCGCAGACCTACAGCGGCTGCGACAAGCCAAGGGCAGGGCGTCGGTTAGCA
CTAACTGAGAGGGAAGTGCGTGTGCTGGTTCGCACGGCGGCGTCCGGAGAACACTTCGCAGCGGAGCTCAAGACCAAGCTCGCGATCAAGGCCTCCGTGC
CAACGATACAGAGGATGCTTCAGCGTGTGGACCATCTTGTGGCGAGGTCGATGAAACCTTTACCGCCCAGGGGGGTTCGTATAGCGCGCTCCAGGAATTC
CTCCTCCAGGAATTGAAGGGGGAAGACTTGTAGGAGTCAACAAGTATCCAAGATTCCACCGCGAAGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTT
GCGGAATCCCTGTCGGCTCGTTTGTCTTTGACGAAACGGCACTTCACCGAGCTTGTGGCCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACT
CTCAACGACAGAATGGCAGAGTGTAGTCTGGATTTCACACCCAGATTATCGGAAATTCAGGATGCACCTTTACCCAGGATGCACCCCAAACACCAATAGC
CAACAAATACAGAGTTATATACAATACAAATAGCCGTCACTTATTCTTTTCGACCCTTGGACGGTGGGTCACT