Description :
From Genome Similarity Track
Location :
Scaffold_39:308254- 309944
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011972Similar to Itch: E3 ubiquitin-protein ligase Itchy (Mus musculus)

Sequence
1690 bases(100 bases per row)
CGAACTCGTAGTTGTCCAAAATGCCAAACAGACACGCCTTGAGCTCTTTCTTCTTGATGTACATGGGCAGCTCCATGTGGTTGAAGCACGGTTGGCCGCG
GATCAGGCGCGAAATGACCAACTCTCGACCCACGATCGTGAACGGTGCGAGTCTCCCGTTGTAGTTGGTCAGCGCCGCGAAGCCGCCGATGGGCACGCGC
GTGTTCCCTGTGGTGAAGTGCAACAGACGTTTCTTGTACTCAATGTTCATGCCGCGCACAAACTTCCAGAACCACCGCTTCGAAGGGTGCGCATGGATCG
TTTCGTTGTACTTGGAGTGGCGCTCCCAGTCGTCGACGTCGATCACGTCCGAGCCGCAGAGCACGTAGTCAAACTCTTCTGGATCAAAGAGCACGAGCAG
CTCCTGCGGCACGACTTCGTAAAAGCCCTTGAGAAACGCATACAATTGCGACTCGACACTCTCGAAGAGTGTGTACCTGAAGTAACGATCCAGGTACTCG
AATTTGTTGGTATCGGTCACGGCAGCGTTGCGGCCATCTGGGATCAAATCCACTACGTGGGCTTGACCATTCACGTGCTCAGTCACGCTAAAGTCCAGAC
CCAAAGACTCGACGTCTGAGTGAGTCACGAGGTATTCCAGGCTCTTGTACGCTTCCGGGTCGAAGAACGCGAGGTCCGTGAAACTAACAGGGATGCCCAG
AAGAATTTTCAGCAGAGGTGTCGCCAAGTGGAAGCCCCAGATGTTGCCGCCGAGCAAACCGCGGCCGAGCAATCGACCAGCCGAGTAGTAGAACGTCAGG
TGGTCGTCGCCGACCGCAAGCTTCGAGTGCGGATTCAAATAGAACGTCTGGTCTGATTTGTTCACGAGCTTGAACAAACCCGTCTCCGGGTTGCCTAGGA
GCTCGTTCAGTTGCACAAACCACTCGCGCTGCAAGTTGCTCGTCACGGTCGTTGGTTCCTTCGCAAACTTGATCGTCAAATCCGCACGCGCGTACTTTGT
GTCGATACAGCTCACATGGTCCAGCGACTGCTCGAGCATGAACTTGCGCGTGATGTTGAGCTTCAGGAGCTGTCTCTTGGTCGGCGCGAGCGCCAAGGCG
CTCTTGGTCACAAACAGCGCGTACTTGGACGGAAAGTCCAAGCTGGCCGCCTGCTCCAGTAGCTCGTTGTCGATGTAAGAGTGAGCAATTTCAAGTGGAT
TGACCACATTCGGAGTGGCTCTGCTGGACTCGACGAGGTTCGATTGAACGTGTTGGGCTTCGTGGATCAGCAGGTCGGTCTTCTTGAGTCCCTTGGTCTC
AAACGCCACTTGATCGTTGAGGTCGAACGTGACGACGTACCCTGGGAACTGCGACTCGGCGCTGGACGTGCCCTGACGGTACCAATACGCTCTGCCTTCA
ACGTCGACCTTGCGCAGCCATTCCTTTCGTTTGCTGCGCGTGCATGAAACATACGCGTTAGAGTAAATAAGCCAAGCGTTTGGAGACGTATATACAAAAG
CTTTTAAGAAGCATACCTGGCACGGAGTCGACGGCCGCTCAGCGCATTTGGTGAACTCTTGGACTTCTTCACTCTCTTTTTCGCGTCTTCGCCGATGGGC
TCACCACAGACGTTGCAGAACACGATGCGCTTGAAATTCTCAAAGCCGCACGCATCGCATTTGTTGAAACCCAGTTCGGCTTCCCTATAT