Description :
From Genome Similarity Track
Location :
Scaffold_12:30825- 47536
Transcript NameFunction/comments
Phymu_g885hypothetical protein
Phymu_g886hypothetical protein PHYSODRAFT_506421
Phymu_g887conserved hypothetical protein
Phymu_g888hypothetical protein PHYSODRAFT_508787
Phymu_g889hypothetical protein
Phymu_g890conserved hypothetical protein

Sequence
16711 bases(100 bases per row)
CGACGTGCCAAAAGCTTTCGCTTTCGCCACCACGTTTGGATGGTCGTAGCGTACGCATTATTCCACATGCTCGTTAAGATTTCTTGGCGGCGCCGATCCT
CCAAATGCACTTTCAACTCGTAGAATTGGGCCCGAGCTCGCTTAGCTCGATACGCGTTCTGTAGCAATACAGCGGCGGCACTTTTCGTCTTTAAAGCGAT
TTCCACACGAAGCCCAAAGCAGCGTAAGAACCGAGCGTACCGGAAAAACTTAAATAACACCCGCCTCGCTTTGATTTGTCTCTCGCTCTTCGCTTTGGTT
CTTGCAATCCGCCTTCTTGTGCGTCGTATCCAAAGCTGAATGGAGATTGCAGCATGATACCGTGCTAAGTGATGGCACCAAGCGAGGATATCCCGCTTTC
TCTCGATGTACCGCACAAAAGTTCGAGTGACCacacgtgctgcttgttgctgcttcatccaaACTGCACAGCGCACTCGGAAAATGTACGCGTGGTAAAA
TCTCTGAACTCGGTGAGTAGCCTCATTATACGCTatgaagcgcttctttcgCTTGAACAGTCTTCTTGATTGAAATCCTCGCCACTTGGCTTGGATCAGT
GTCGCAGCTTGGTGGAGGTGATGCACCTCTGCTGCGTGTTTCCCTTTCACCCCGCGTATCCAACTTTGAATggcaactgctgcagctatAGCTTCACTTT
CGCGCTGACCAACTACGGCTGACATCCATCGACCCCACAACCGGAAGATTGTGCACTCTAGCCTCTTTCGCGCTCTTTGAAGGATCCATAGCGCACATTT
TCTAGAGTTGAAAGTTAGAACAGAAAAAAACATTAGTCCTGCTCATTGAGAAAGAGAATACTACCATAACACACAGGCGGCAAAACGTTTGGATCTGTTG
GAGGGACTGCAACCATTTTGTTTGCTGCCACCAATGAGCAAAGCGTCGACGTTTAGCACGTTGGCAATATCTGGACATGATAACCTGGGAACAAAAAAGT
GAAGTAAGATCGCCGATGAAAGCTCAAATCTGAGTCAATGGTGTTCGTACCGACAGTTTTTCGGCTGCAAACTCCTTTCTCATTGTTGCGGACCGACTAA
TCTCTTCAATACAATTATCGCGGACCCATTCTCGTATTTTGAGTGGGCAGTCTGGGGCAGGACGACGATCCGTCGGAAAATTTGCTTGTTTTTGCGGTTT
TGCTCGATTTGCTCGATTTGAAATGCGGGATGGCGTTCGTGTAGACGCTATCACCTGCGGGAGCACAGTCCTCGAAGCAGGTGACACTCGACCATGAATC
CATGCGTTTCGCGCAAGTTTATCGCATAACGAAGCTGTCGATTTGTTTGAAGAATGACTATAAACCCACTCGTCTTGCCGACGGAGCATGACGAGAGCtg
tctccagctccatgaCTTGATCGTACGATAGGTCCAATTCTCGCAGAAAGCTCGCACTTTCTACAGTACTAGCCACCTTTGGATGTACAAGCAAGAACAG
AATGTCTTCTGAATCCAGGCATTTCAAGTGAAATTTGTCCTCCCAGAGTGTAAGTGCATGCCCCTGAAGGCGAAAGCGGCCTGTTGGAGTTCGTGCGCTC
AGGTGTTTAGTAGCTGCATCAGCTCTTGATGAAGTCCATGAAGGTTCCAAGGTTCCTCGTAGTCGCCCAACAGATTTATTGAGTTTGCAGCATTTTTTAT
CAGGAACATCCCTTGTTTTCCGCCTTTTGCTGTCAACAGAACTCAGTTTTGGTAGGCTGGGTGTCAGCAAGGAGCGTGCCTCACAAAGATCCCTCTGTTC
CGGCAAAACTTCATCTAAAATGCTTGCCACACTCCATTTCATCCCGTTCGtccaagcagctcggcgCTCCATCAGGTCCACGAATCCTGCTAGCCAGAAG
AAATACGCATCAGTTCATTCCTCCACCACGTTCCTTCATCGATAACATTTTGTTACCTTCATCAATTGCCCTGAAATTAGCTTCTCGTTTCTTCATCGAT
GCAAGCGCATGCGCTAATTTTGGGAGCGTATTTACTCGAGCTCGACGCGCAAGTTGAGCTCCTTTGCCTCCATGAACGTAAGAAGCTCCTGgcattcttc
ttcactcaAGTAGGCACGCATTATACGAATCCCATCCATGTATAGTTCCTTGCTCCAcgcacaagcagcaattCCTCGGTAAAGCACCTTCTTCGCGGCA
TCCACCTTCCCTAGTGCGACTTCGAAGTGCATGTATAGCCGCCAGCAAAGCGCGTTTCCCTTTGTCCGAATTTGAGTAGCCATCTTTTCAAACAAGCGAC
GGATACGTGAAACTGCAGTCGCATTCAGTCCCCAGCGATGAAAGAGGCAGCATTTGGGACGAGAAGATTTGTCGATGCTGGACCCTGTGTTCATTGATAA
CTCCATTAGCGTAGCGGCCCTCTCAGTACGACAAAATTCACAGAGCAGCGCAAATAACCACTCCACCAATGCCGGCGAATCGTAATGCCGCCGCCATCGC
TTCTCGACTCGAAAAAAGTAGTTGCGGAGCACCTGTGAAATAGTGTTCCCCGTCTCAGAATCGACAAAGAGCCGTAGAAATAGCTGGTTGTTCGGATACA
TTGTCACTGCTTCGCCCACAGCCGATCGCCATACACGTGGAGCAAGTGCGGGGAATACAGCCGAGACTTGATGTTGCTGCATGAAGTCTAGGAAGCAAGT
CCACATCCATGAAACATGTAAGCAGTTCTTatgctcttcagcagccaagaCTTGTCGATACTCGTGGCAAGCTGCGTCAAATCCATCATAGGCGTACACT
ACGAGCGCCAGGTTGTGCAAGCAATAACCAacccagcagctcgatcGGAATAGTGGTCCGGTACTTGCTTCACAACCCCCACAGTTTCTTGAAATCGATT
CTGCACAACATTGAACGGCAAAGCCGAGCTCGGCACGATATCTTGCAATAAGACCGGCTTTCGTCGACAGATCCGACATCAAGTGCTCCTTCAAGTAATC
ACTGGATCGCTTCCGATATTTTTTCGTGATTGTCTCCAACgtttccttcttctctccacCAAATCCCCCAGATTGCAACGCAGCCCACAGTGTATACAGA
CACCGCAACGTCTGGAGCTTCCTCTTGGCTCGAGTTTTCATTTCATCACCAGAGGACGGCCACATCTCAAGGCGAGCACGAAGAAATACAAAACGCTGGA
AAGCTCTAGCTTGAATCGCATCTTTTGAAGAGGGAAGGCCAAGTGCCTTTAACGTATTGTCACAGATACGTCTGACGTGGCGCTCATTTCCCAGTCTAAG
CTCCAACTTGGCATAGGAATACAGTACATTGAAGTCTGTACTGCCGTCGGTATCTCTCCGAGCTAATTCTTGACTCAAATGTCGAACATACGTCAGACTT
TCCTCTGACACACCGACTGTACACGTAACTTCAGCATCAAATCCAATCCACAAGCTCTTCAGTGCACTCTCAAACTCTGCATCCGTTTTGGCGAAGATAT
CCAACGCCTGTGCGAATATTCGACGAATAAACTCCACCTTACTGGGATCTCGGAGTACATCTTGCTTCACTGACACGTCTGTAAGAAGAGCATCCTCGAG
AAGCACCTTCCGGTCACATGGATCAAGAAACAATTTATTGTTGTTGGAGTTGCCTGAATGAGGGTCAAGCACGAAAAGGATCGGAGCCACGAGCAGTTCG
TAGTCTGCAGGGCAATCCGCATACACTGATTCATCAATCGGAAAACTGGTTTCCCATGCATATTCGCCTCGCCATCTCACACCACATATCTGCAACAGCT
CGGCAATAACCCGCCATTGATACGCCACCGGAACAGGAAACAAAAATGGCTGGACTTCTTCCGTGAGAATGGCGCGATCCGGTTGCTGCTCAATGAGGTC
TTGGTGAAGAGGGTTACTGGAATGCAGTGGAGCCCATTGCATttctgcttgctcttcttcgcgcatAAGCCAGCGTACAAAGCGGTCATCATCGTCAATT
AGACCGTAATTCGCGCGCTGGTCCTCAATTTGAGCCTttgtcacttcaacttctgcgCGTTTCATCTTTTCCTTTTCAAGCAGTTGGTTTTGTCGAGAGT
GGGCACTTTCGGTGCCGCGCAGCTCTCCAAGGATGCGTTCATAATTCCCGGAGTcgtcagcttcatcgacaTTAATGCGATATCCATGCAAATTGCTGTA
GATAACTTTACCGCCTCGCTTTGAGCCTTCTTCCGAACTATCACCAAACGAGAAGTTCCCATTCAGTACGGCGATGCCTTCTTTGCCATCCAACATGCGT
GATCTACTTTTTATACGTGAACGGCGCTGGTATGCTGCAGAGGCAGACAAGAggctctgctggtgctctTTAGTACGCAACACTTCAGAAGGATTTACTT
TGCCAGCAGAAGTAACCTTTTCCTGGATGTAGTGTCGAAACTCAGCATCAGACAGCCTAGGGGCTTGCTTTCCCAGaatttcagagctcgagTCAACATT
acctcgatcttctccaatCCCGTTGAAGTCTTTTTCATTCCACCGTAAAGCAAACTTTCGCAGCATTTCCAAGTAATAACCATTACCGCTACCCCCAATA
ATCGTAGATCCTTCGTTCCAACTAAAATCGAGTAGAGCTTGCAATTGCGCTATCGCTCTCTCGATAAAGCCTGCCTTCTTTTCAAACTGGCACATAAGAA
AGTGGAAATCCAGAGGCGCTATTGCCACACCGTCCTCTCCAGTTGAGTCTGGACTTGAAAGTGGCCGTTTAGTCTTCGTTGTTGTAGCACTTCCGCTTTC
AGCTCTGAGCACAGTAAGAATACGTGCGTAGAGATCGCGCACGGACTGCATCGAAAAGCTCCcgaagtgctgctggcggcttAGAAGAAGTTTAAACCAG
AGCTCACCGTTCGTAGAGTCTTCAGATAGGAGGGtctcaagttgctgctgaaatgtgctgctgcctcttTCGCGAGACAGCAATGACATGTTCAGCTTAA
CGCGATGCAGTTCCCGTGACTGAGGATTACTCGCCAGCGCTTTTGTTAGAATTGCAGTTTGCTTTTCCACAATACTTGCGTTCATCGCTGAGGTTGACTT
GGAGTTTTTCGGGTGAAGACGCATTGTCTCCTGTTGGAAGGCCATCAAGTCGAGCCAATTATCAACGTCATGCGGATTTGCTGTGACAGCAGCATTGAGC
ATTTTGCTGCGTTCCACCAGGTGCTGCTCAACGCTTTGTCCGTCAGATAGCAGAACTCCATGGGTGACGGCTGGGGAATTATCGCTGTCTGCACTTGTAG
TACGACCCTGAAGCTCGGCACCATCGAGCACTGGATCCAAAGGAATAAAGTCCATTTCAGTTTGACGGTTGCAGACAGTGCTAGCATCGTTGCTATCAGT
GCGAGACAGCCTTTTGTTCGAGTAGGCGAGATAAAGTCGCTTTTGCCGGCCATCTCGCTCCAGTTTGCGTGCCATTAATGAAAAATATCGACTCGAGTCT
GGTtcatccttcttcttgcctggaatctcgctgctggtgaatTGTGGCCGTGCTGGGGGTAACTTTGCCCCCGTCAGAAGGCTCTTCCGTGTAGCCAACT
TGTACAGTGGTTGGTCATGGGCGTACATGGATCCAAAGAACTGATTATCGCGATCACCAACGCGATCGAATTCAAAAATCTTCTTgtcatctcctccttc
cttTTGGTCGTGAATCACAACGTCCGTTGTTGGCTGTTTCACGATCCTAGCGTCGACCCTGTATCTGAGCGATGGGGACTTTGACCTGGAGCGcgacttg
ctgttgcttcggCGCCGATGCCGTCGATATCGACGTCTAGAACGCGTCCtgtcttcgccgtcgttgctgctATCGGAATGACTCCGCGATCTCCGGCGCT
TTTTGGTCTTGCTTGTCCTCTTTTCGAGGTGTTGACTCTTCGTATCCTCACTGTGTCGCTTTTTCACCTTGTGTcgtttcttctcttttttGTGGCGATG
CTTGTAAACTTGTAATGCTTCAGTGTCTTCTGGTACGCCTTGCTTTGCTTTATCGTCTCGTTTGGTGCCATTAAAACTTTTGCCGACGCTCAACCAATCT
ATTCCACAAAGGGGCACATAGTTAGTGGTGCAATCCAGGTAGGTACTAGCAGTCTATCTATCTGTGAACCTTCAGCACTGCCTTCGGTGTCGGCAGCGAA
GCCCTGCGCGGCAGCATCCCGCCCTGATGCGAACATAACAAACTGGACTATAGGTAAATTGGGACTATAAATTTAGTGGAGACTATATTAAATATAGTCT
AAAGTTTAGTCCTGGAATATTCGCATTCAGCAAACATGAGCGGGGAGAAGCTCGCTATACAGATGCCGCCCGTGGACCTGAcgaacgaggaggaggtaTC
CGCCTACATCAAGGCAAAGATCCGAGTGTATAGCAACTTCCCCAAGCCTGGCGTGGATTTCAGCGATGTCACTTCATTGCTTCTGGACCCCGTCGCCTTC
CAAGTGGCCATTGACGCCCTCAAATTGCGCTATCTGGGCCAGGGCATCACCCACGTAGTGAGCACCGAGTCGAGAGGATTTATCTTCGGCGCGCCATTGG
CGTTAGCTCTCCAGGCCGCTTTCGTGCCAGTTCGTCGTGCCCGGAGACTGCCTGGAGATGTCGTTGGCGTGGACTACGTGTCAGGCTTTTACAGCGGCCG
GATGGAAATCCACGAGGATGCCATCACGAGCGGAGGACGCGTTGTCATTATCGATGATCTAGTTGCATCGGTGCGGCAACTTATCATATTTTCAGTAGTC
GTCGCAAAACTCACTATGCGATCGACTGTCGTTTGTTGTACAGGGCAAAACGCTCAGGGTGACGGTCGAGCTTGTTGAGAAGCTCGGTGGCGAAGTTGTA
GAGTGCGGCTGTGTGATCAACTCGCTGCATTCGACGGTACGGCTGTCTTCTGGCTATTGAATGATTTGTGGTGCCGAGAACTGACCAGTGCCTGTATTGC
TATCCAGGAATCGCTACCGAATGTCCCGTTGTATGGCCTCACCAAGCTGTGAATAGAGTGCTTTCGTTTTCTCCAGAGTTGCGTTTCGAACCCCTTTGAA
ACCCGAATCTCTAAATACTGTTTACTGTTATATTGTGGCATTTGACTACTTGCGCTATGCAAATAAAAAGCTTTACATATGTATCTTTATTGTGAACGCA
TCCTTTAAAAATGAATTATATAAATAATTACAAAAAGAAGTTTTGGATGTTTCTGGCGCTTCAGACCTCGGAATCAAAAAACGAAAAAACcgcgaaggag
gaagcgacCTGCAGGATGTCGCCCAAGCCGCGAATCCGCCAGCGCTTCGGGCCCAGCCAGGACTATCTGCTAGTTGTTCAGGTGAACACGGACCTGCCGT
TCCGCGCTCCGTACGGCGGGCTCATGGCCGGTTGGGAGAAGGTCGCCAAGACTCTTAACGGAAGCAGCGCCTTCAAGATGCACCATCTGAAGGGCCCCAT
CGCCAAGAACCGCTTCGAGCGCCTCGTGGCGCGCCATCGCAACTGGGTCAAGAATGGTAGCCACCCAGACGACGTACCATCGCAGGACGAGGCCTACCAG
AAAGTCATGGCCGAGGTAGTACCCAAACTGGATGCTGCCGAGGCGGATCCGCAGTCCCAGAAGCTGGGAAAACGTGGCCGGCCCCGAAAGATCAAGTCGG
AGGACGGAGAGGCACCtgtcgagaagaagcccacGCTGGGAACAGCACAGGTGACCATTGCTCCGTCGCCGATGGGGCCACAGCCGTCGACATCGTCCAC
TTCGCTCCTTGTTGATTCTGAGGACCAGGCGTTGCCTGGCGCCAACAAGGCCACACGTCAACGGTTCACTCATGCAGATGACCTCTTGCTCGTCAAGTAT
GTGAAACAGGTGCTCCCTTTCCGTGCTAAGTTCGGAGCGATCTCGGCGGCGTGGGAGGATGTGGCGTACAAGCTGGACAATAGCCCAGAGTTCTCCAAGG
ACAACGTCAAGGGCCCCATTGTGCGCTACCGTTTTGAAAACCTCATGGCCAAGTACCGTGAACGCGTTAAACTCAACAACGGTAGTGTTGTAGGACCAAA
GGGTGCTCCTGCGGGTgaacttgaagtgctcaTGACGGAACTTGTGACGCTCTACGATGGTGGAGATCCTGTCAGCGCTGCTCTACTTGCTCAGAACGTG
GCGATCGCTACTGGCGCAGTCAATGCCGTGGCAGCACGGACTCCCTCTCACGCATCGTCGAATcaagatgaggacgaggattCAGTCAGTAGCACGCCAA
GCGAACCGCTGTCACCGGTCGGCAACTCCTCCGGAGTGGCCTCATCCTCGACCCAGAGCTTCATCACCCCGACAACCAGGCCGGTGGTGGCTTCGGCATC
AACGAGCTCAGCAGTGGCATTGGCAGGCACGGATCCTACTAGTATTGCcgagctgaaggcgctgcttCAGGAAATGGTGGAGCAACAGTCGCGGGCCATG
GAACAaatggtgctgctgcaacgcgaAGAGCGTCGCTTGGAAACGGAACGGCGAGAGCGGGAGTTGGAGCATGAGCGTGGAGAGCGCGAGAAGGACCGTG
AAGCGTTGACGTCCGCTGTGATTTCGGTCATGAAGACATTCCTCGAGCAGAACGGCCACAAAGACTGAGAAGAGTTTGTAGTTGATATAAGGGTGCTATT
CTTTTTAGCAACATCTCTGTAGTACACGATCGAGTGAGTATCGCTCGCATCGAGAGGATGTATAGCAGCACAGTATCCGGaattgagctgctcgattCGA
GCAGAGTCTGCAATATCGCTGACAGTACAGTAGCAGCTGACGATTTGCTAGCATTTTTGCGGGTCTCAGTCCAGCTGGCATCATCTTTCCCTCTTCATGC
CACACTTCCGAAGAACGTATCTAATCACATAGAGAACAATGTCCGAGAACGCTGGCTCGTGCTTTGCCAGTAGTTGCTGCGCGACGTGCTGTGCCAGCAG
AGGCACCTCTGCGAATGACAACCGCCGACGCCTTGCAGACGATGACCCTCGTCGCCGCGACTACGATACTTCGCGTGATGTGACCGTGCAGCCCGTGGTG
ATGTCCCAGATCCGCCCGCCGCAGCCCCAAGTACGCGCGAGCTCCTAAACTTGAGGCGGAAAAGAAAGAGACCAAGAGTGTATTGCCAcagtgcaacttg
cactGCAAGCTCCTTCACGATACCACGTTCAAGTAGTACTGTAGTTCGCAAGAGCAACTTGAATGATAGTGCCAAGAATCGAGAGCTGCACGTGTGGATA
ATGAATATATTGCATTGCCAGCAGCGGACGGGGCGTCACAAGCGCATTCGAATGCTGCCGGTGGATTATGATACGTTTGAACGTGGGTAAATTACCCGCG
TATTGCTGTGCTCGTTCTGAGACACAACGATCGAATACAATTGTCAAGATTGCACACGCCGTGGACTGATCAATGCATCCCCTTGCAGAGCTCTCCTGTC
CATTGCAACAATTACCGGCGGAGTAAcaaacgagaagctcgacAAGTGAGCGAATCCAGTGAAGGTAGAGAGACCAAGGCGACCATGTGCGGACCTGATG
ATGGTTGCGGGGACGAGTGCTGCGGGTGCTTGGCCGGTTTGTGCTGTGCCTCGTGCTGTCTAGCAGGCGCTTCGGCAACAGACAACGATCGTCGTGATCG
TCGCGGTTGCGACTCACCTCCTCCAAGAGAAGTGTACATTCAACCGGTGGTCGTACAGCAAGGTTATGAtcatccaccaccaccaggGTATGGTCCTCCA
CCGCCAGGATATGgccctcctcctccacctccaggaTACGGaccgccgcctccaccgcaCCGTGACTACTATTAGCATCCGACGGCGTGCAAGCAAATGT
CATGCACCCCCTCCACGGAAACGCTATAGCACGAGAAAACTTAATGAAACCCCTTTTTGGTATTGTTCGAGACGTTCATTGTGTCACCGCGAGATGCATT
GCTTTTCTTCCGAGCTTAGCACGAATCGTGGTCAATGCAACACTTGACTAGcggcgctgcttggcgtctCTCgtgagaagctcaagaatttgctgttgat
gttgaagtggtggtCTCAGATTTTGGAATCAGAACGTTGAGAACTGAGGAGAATCAGCAATACTACAATGGGAGGGGAGACCGTAGTCGGCACGCGACTA
CACTGGCACAGTCATTCGCAGCGCGACCgcatcgacgtcgacaaggtgctgggcCAAGTGCGTGCGTTTTGCACTCGCGCAGCCACGTATTCGAATGGCG
GGATCTTGATTGCAGTGGGGTTGCCCGAGGCGATAGCTGACTCCTTCGTATCCTCTCACTCGCTAGACGGAGATGCACCTTCATCCACTGCGTTTATCGA
TTCTGTGCGCGAGTTCATGACAAAATTGCAGGGAGAAGTTAATGCAGAGACTCTAGCCGGCAAGGTGGAGATCGTCCCGATGCTGTATTGGGGCAAATTC
GTGCCGGCCTTGAACGCGTTGATCGGAACGGCGGCCGACCACTTCCCCGATGCTGACACACTAATTCTGCAGTCATTGGAAATCGACGTGGATGCAGCTA
GTGTGGAAGCGCTACGCTCGCATTTTGACCTCAAGCATGACCTGGTGGTGGGCGCAGCACTACCTGGCCACGACTTCCAGCCGAACTCAGCTAGTCAACC
AGTCGAATTGACAGGCCTGACGTCGCCTTGGAACACGCTGGCGCTCTGGAATCTGGACCAACTGACGAAGGTGGGGTTTGCACTCATGGGAGACGCATTA
CGTCTCGAAGTCGACGGGATTGGCTCCGCTGCGGGTATCGAAGAAGTCGCCACTATCGCcatgtaccagcagctctacgCAAACGGCACATCGTCTACGA
TTGCCAAGTTGGTGCGGGTGCCTAGTATTGCGTGGCAATTGGACGGATTGCAAGACCCCAAGCGGCTCGAGTGGCACCAGAAGAAAATGGcgagcaagca
gcaacgcgccGCCGCCCAGATCATCCACTTCGGCGGTGTGGCTCCTGGCCGCGTTTACCATTTGGAGGCGTGAAGTGGGAAGTTATGAGCTCGCATCACA
ACAAACTTTGTATCTCCTAAGCAATAGGCAAGCAGCCAAGTAACGAATGAAACTTTGCGTGGCATGCCTCAGACTTGAGCAGGTCCGTTTCTGAATCTGA
TACCGCACGATGTGACACAGTCACTTCCGagcagcgactcgaagcAAACATGCGTGGCACGACGGTGGTCGGCACGAGGTTGCACTGGCAGAGCCACACG
CAGTATGAGCGaatcgacgtggagaagttgctgcgtcAGTTGCGCGTGTTCTGCGCGCGTGCAGCGGCGTATGCTGACGGTGGCATTCTCATCGCTGTGG
GGTTTCCAACCGCAGGGGTGACACTGGCGCCAGCCGCGGGCGCTGCAGATGCGATCTCGCCTACATCTTCCAAGGCCTCGAGCGCCTTTGTTGACTCGGT
GCGCGAGTTCATGACGAGACTGCAGAACGAAGTGGACACGGGAGTTATCACAGGCAAGGTGGAGATCATCCCGATGCTGTTCTGGGGAAAGTTTGTGCCG
GCGTTGAATGCTATCATTGGTACAGCAGCCGATCATTATCCAAGTGCTGACACGCTGCTACTCCAGTCCCTAGAAGTTGaggtggatgctgctggagtaA
CGTTGCTACGATCGAACCTCGATCTGGAGCATGATCTTGTCGTGGGCACGGCGCTACCTGGACACACTTTCCAGCCTGATCCTGCTCTCCAGCCATTGGA
GTTAAGTGGTTTGACGTCACCTTGGAATACGCTGGCGCTTTGGAATTTGAAGCAATTGACGAAGATCGGCTTTGCTCTAATGGGAGACGCATTGCGTCTG
GAAGTCGAGGGTATTGGTCCTGCTggcggagacgaagaggTCTCGACGATCTCAATGTACCAGCAACTTTTtgcagacacagcagctcctACAAGAGCCA
AACTTCTTCGAGTAACTGGTGTCATTTGGCAGGTGGCCGATTTCAAGGATCCCGAGCGAGTTGCGTGGCATAGTCGAAAAATGCggagcaagaagcagcg
cacCGCGGCACAAATGGCGCAGTTCGGTGGCGTGGCTCCAGGCCATGTATACCACATAGATCCTTCGCCTCCAAATGGCAACTCAAAGTAACGAgatgct
acatgtagacgtAAAGCCTATCGATAAACAGAAGAACAACtcgataaaaaaaaacttttcATGAATTGATAACGGCGATCTGCGACACGGTAACGGGCAT
CCGGTAAACTACCGGTATCCAGTCTTGAAGCCAAAGGTTTCCAGCGACAGACGACGTTACGGCCGGACGGCGAATGAACTCGGGCGATGGCATCCAAGCG
CGCGCAGCCTCTCTGCGCCAGGAAGCAACTCGGCGATGGCTCgtgaaggacgagctggtgttcctgctgcagcattaCAAGTCGGTGGGCGTACCGGTGG
CccacgcgctgcagttgcgGCCGATAAGTAGGTGTCGACGTCGCCTGGCCGTGCATCAGCGCTAAAACGGCACTAACGCCCTCTCTTGTGGCCAATAGGC
GGCACTTTGCTATTCTATAATACGCAGGAGGTCTCGGACTACAAGAAGGATGGATGGTTCTGgcagaagcgcaaggacaaGAGTGGGCGAGTGCGTGAAG
ACCGCGCCAAACTTGTTATCAATCGCGAAGTCATTATTCTAGGGACATATGTGCACTCCGCCGAGACGTCGGTGCGTTGGAATACCTAGAAATGAACAAC
AAGTGTGTGTAGTGACTTGTTGCTACTGCTGTAGACATTCCATCGGAGGATTTATTCAGTCCGCGACTCCAAGGAGAGCGTTGTGCTCGTCCACTACTTC
GATGAGGTCAATAAGGAGCTCGTGAATCGTCAATTGTCCTCGGACTCGAGCAAAATCGACCTAAACTCGAGCAAAGGGATCAAGCGGGCGCTATCTGCCA
AGACTAGCGGTGCTTCCTCAGGCTTCACGCCGTCGTTTCGACAGTTGAGTCCTCTTAAGTCCTTGTCGTCTGACGAGACGGTCGAATCCGTCATGAAAAG
TATGCAGGCAATCTTGATTATGTCTTGAGATGCTGAGTGGCTAATTTTCGTGCTATCGACTGATGTTCAGACTGTTTTGAGGTGGATGTTGAACCCCACA
CGGCACCGGAACACAGTCCTTCGTTCAACATCTCTGATGCGGATCTGCTGTTATTGAAGGACAGTGCAATGGACGGGATTATCACTGGCTTTGAGTCTGA
CGAGCTTTTTAACGACCTGTCTTTGACGACATCACCCGAAGAAGGTGTCTCCGGCCTGGGAGGCCAACAAACGTTTGAGCTGGCAGAAATATCGGATTTC
TCGCCGGACTGGGACTttggagacggaggagccAAGATTCTAATCTGCCTAGCAGCTAAACTTCCTGAGAGACTGGCTCAAGATCCAATGAAGCTGTTTA
TTCAGTTTGGCACGAAGAGAGTTCGCGCAGATAAGGTTTCGGACACGGTACTGCGCTGCACTGGTGCGTCGACATATTCTGGTGGTGTCTCTAATGTGCA
ATAGGGAGTAGCACTAACAATTGGTGGATGTGCTGTCtacagctccaagttcgcGAGAACTTGGCAGCGTTGACCTTTGCGTGTGTCATTGGGGTGGATC
GCTGCAACAGGAGAGTATTCAGCTCTCTCACAAGAGGCAGTTCACGTACCGAAGTCACTATTTGGTGTCACCTTCGCTTGTTGGCGAAATTGCGAAAGAC
AAGCGTGTTTTTGAATCAGAATCGATCGATCCTTTGGAACTGACTGCACCAAGTCCTGTACATACTTTTGGCACCGGCAAGAGAGGTCGATCTCCAACTG
TTCTATCCCAGACTGTTGGAATGAAAAGGCCCGAGGACAGATTCTCCAACAGAAACCTATCGACATACGTCGAATCAGATTGTAAGTTTTTGATCCTATT
GATTGACTGTTTGCATTTCGTTCCTAGATACTCACGTGTTGTGGCTTTTGTACATTATAATTAGTGGATGAGCGCCAATGCAAGATTCGCGTCGTAGAGC
GATTGTCTGAGTTTCACCAAGCTATACGCACCAAGACAACAACATCTCCATCAAgcagtccagcagctttcggCGCCGGAAACGTAAGCAGCGTGGGTCC
AGAAAGAGAAGACCCGGCGCCTTTATCGACAGTATCACCGACTTCAACTAGCCAGGTGCAACATTCTAGCCAGAAAATTGCTCAATCAAGTGGCTCTGTC
GAGCTTTCAGGTAACTCAACTTCTGCCAGCGAAACATCGACCGCGTTGGATGACTGCACAATCGAAGCTCTAAGCGACAACGATTTGGAGCAGCTCTCAG
AGAAATTACTCGAGCGTGTTGTGCGTCAGCTTGTTACAGTCGCGCACACGAATGAagaactgctggaggagctcaactCCCTGGATGAAACTGGTTTGAG
TCTGTTGCACTACGTGAGTTTCTACAACTATTCGCAGTTGGTGCCGGTATTGGTCGCTCATGGCGCCCACATTAACCAACAAAGCACCCAAGGACAGACG
TCACTACATCTTGCAGCAGGATGCGGGCACAACGAAGTCGTCGACGTCCTGCTACAATCTGGTGCGGATTTACACGTGCGCGACTTTGATGGACTCACTG
CTGCCGACCGTGCTGAAAAGTCTGGACATTTAGACGTTGCTGGAAAATTGCACCAGCACATGGGGGATGATGATACCAGTGACTTGGGTGCAATCGATGA
GATTTATGGGTTTGGAGGATCCCCCATGGAGATCGATGACGCCCCAACACCTTACACGGATGCCGGAGATATGGGCCTCTTGGTGGACGATGCCCACGTG
CCTTGTGTGCGCCAACAACGTTCTCACTCGAACAGTTGTGAAAGTCCTTGCGAAGCGAGCTTATCGTCAAAGGCGACATCTTACGTACGTGAGCTTCATA
GTTTATGCTGGCGGACCATAGTGCTAACTGAGAGAATTTCTCTGACATCAGGTAGGAGAGAATCAAGAGCACAATCGCAAGCTTTTACTTGGAGCCTTCT
CGACCATGAGCCTGCACGACAAGTGTGCTCTCTCGTTGAGTATTTCAAGAGATTCTGCGAGTCACGTAGCCCGACGTCGTGAAAGCAGCGTTGGTGAAGA
TGTCCTAATCTCTCCCTGTAGCAGTAGTACGGGGACATCGGTGGGCTTTGGTTCGTCGCCGGCAAGTATGGTTGGCATGGACTCTAACCTTGTCGGCGGA
CGCTTAGTCTTGTCTGGAGCTGAGAACGACTCGGATGTTCAGAGTGTAattgctgaagacgaggaaaGTTTAAATAAGCTTCAAGCAGCGATGGAACTCA
TGGGCCCAGAGGAACGACAGTCTCTGGAAGACGAGGTcaaagtgctgcagcacggGATCCGCgtgtggctgctgaagcggaaCTGCAAGAACATGCGGGA
GACGACCAAACAACTTCGCGAAGCCACGCAAAGTATCGAGGACCAACAGAAACAACAGGAAGCTGATGAGAATCGCTCTCTGATGGCCAGCGACGTCTCA
GAACGTGAGCGCGCCGCCGTGACCGTCCAAGCAGCGACTCGCAGTATGTTGGCTCGACGCAGCTTTTTACAGACTAAGCACGTGGCGATCAAGTTTCAAG
CGGCCACGCGCGGCGTGCTGTGCCGCAAAAACTTCGCACGTATGAAAGCACACGCTCTTGCGTCATTGGTGATCCAACGCAATGTTCGCGAGTGGTGGAA
CAAACAACCGGCTGCAATTCGACCTGGCAGCGTTGACAGAGAAgccgaggaagaggaagaagagaaagcgTTAATCTTGCAAGACCCTTATGAACAAGCA
CTAAGCGATGAAGTACAACGCAAGTTGTAAAACTCAACAGACAGGAAGTAAAGCATACCCCACCCAAGTTCTTGTACGCTTCATCTCTTGTTTCTATTTG
CCACTTCCTCAGTGCATCAGCGGCTGTAACCTACCACAGGAACCTGTTGCTTGCTAAAGATGAAGACGTCTTAGTCCATGGCCTCCTCTCCCTCGTCCGT
GTATCGTCGGAAGCCCGGAATGGGAGGCGTCCAGGTGGCGAAGCCGAGCTCCTCGGGTGCAGGTGCATCGTCGGTTTCCATCGCCTCGGCCTGCAGCTCA
GCAGGGAGCGCGTTAATGGCCTCCCACTTGAAGTCGATCTTGGTCTGCACGTCGCGCATAAAGTGGTTGTGCTCGATGGAGGTCATGACGTTGTAGCGGC
GGCCGATCTCCTGGTgacgctgcttctcctcctctgtcCACTCCTCCCTGCAGTAAAGTACGATAATTATTATTTAGACAATAATAGCAGTATCAGCGAA
AGCTGTAAAGCAACGTACGCGACGGGGTACTGGCCCTTGATGGCACGCAGCATCTGCTCGAAGTTGGTGTCGCTTCCGCCcttcttggatttcttcttgt
ccttcttggaaGCGAAACCGCGCACGCTCGAGGAGGCGGAAGCCACATCAGCCAGTGCACAGGCGGTCGCGCGCTTGGCGGCCGCAGAAGTCACGCTACG
CAGCAACAGAGCCATGTCGAAAGTTGCCGAGCTCTTCTTGCACCTGTCGGAGTCTCTCGACCACAAAGTGCAGCCGGACTGCACTAAGTACGAAACGGTG
TCCACCACATA