Description :
From Genome Similarity Track
Location :
Scaffold_129:30824- 33530
Transcript NameFunction/comments
Phyra_40892AC091774_21 putative ribosomal protein

Sequence
2706 bases(100 bases per row)
CTTAGAGTGACCACACCGGTAGTTGCTATTGCTATCCTATATTTAGCAGCGAAACCACATGTCCCCTGGCTGATAGCATCAGCCAAAAGCCAATTTGACA
CCGGTGGTGCGGCTATTAACTACGTTGAAGCTATGGTTGATCAATTTTCGTCGTCTTGGTTGACGGACTTGCTTGATGAGGGGAATGAAGAGGAAGCTTT
TGTTCTGAATTTAGTGTTGTCTAAACCTAGAGGCTTGGATTTGTCGTCGTATCCGAGTGGTTCGAGGCCAGGCAGAGCCGCAAACAAGGATCGTCGAGCG
GCCGACCGTCATTTATGTCTTCTGCAGCAGTATTTCGGACCAAAACCAGTCTACGACTCATCAGCGTTCCGAAAGCGCTTTCGAATGACCCAACGTTTGT
TCACAAAGGTGCTGATAGCAGTCGTTGAGACCGATGACTACTTCGAACAGAAGGCTGACGCTACCGGTAAGCTAGGCATCTCGAGTTTGCTTAAAGTTAC
TGCTTCATTACGACAACTTGCATATGCATCTGCTGCTCACGCGCTTGACGAAAACTTGGAGATAGCAGAAACTACGGCATTAAAATGCTTGAAACGCTTC
TGTCGTGCTATCATCGCGCGGTTTGGCAGTGCATATCTTCGGTCACCAACACCAAGTGAATTACAGGAAATTCTACAGGAAAATGCTCGCCGTGGTTTCG
TTGGGATGATAGGCTCAGTAGATTGCATGCACTGGCAATGGAGAAATTGTCCGACTGCACTGGCTGGACAACACAAAGGGAAGGAGAAAAAGCCCTCTAA
GATTCTTGAGGCCGTCGCAGACTACAACTTACGAATTTGGCACTGCAACTTCGGGTCTCCAGGTTCTCTAAACGGTATCAACGTTCTGGACCAGTCTCCT
TTGTTTCAAGATTTTCTGCAGGGTACTGCTCCCCGTGTCGAGTTCATGATATCTGGTACGATGTGCTTCTTCACATTGGCTTTCTTAATTACTACAAACT
AAATGTGAAACTCGTAGGAAAGCCGTATGACACGCCGTACTTGTTGGCAGACGGAATCTACCCTGAATGGCTTGTGTTTGTCAAACCTATTGAGAAACCC
CATGGATTAAAACAAAAGCACTTCGTCAAGCGACAGGAAACTTGCCGGAAGGACGTGGAACGATGCTTCGGTGTGTTACAAGCGCGATGGCGCTTAATTG
ACACTCCCTGTCGTCTTTGGCGGGCAGATGCAATGGCCCACGTGATGCACGCTTGTATAATCCTCCACAACATGATCATAGAAGACGAGCTCAGTGATCC
CTATTGCAATGGGCATGAGCATCTTTACGATGCCGAGGCGCAGCCTGGTGGCATTCCAGTATTCAATATTGTTAGGCCACAACGACCACCGCGATCTTCT
ACAGTTGCTACGCTGATATCTAAATCGCACAAACTTCACAACGCTAACCAGCACGCTCGGTTTAAATCCGGTCTCACAGATCATCTCTGGACAATGCGCG
GTCTCGAAAACTAGTTAAAATTTGCAATATACGACCCTTGTGGTTTGAACTTAAGCAGTGCTAGATAATGAGCGATGATACAACATCGGGTGTTGTCGTT
GCAGTAATTGTGGGGGATGATTGGGCTGCTGGAGTTAATGGCGCGGTAGTGATGGGCTCTGCTCTGGCTGGATCCGGCTGATCACCAAGCCGAGATCCAT
GTCCTGCAGCTGCAGGAGTCTCTGTGTCAACAGCAGCAACCTCTTTACGAAGTCGTGCTAACACAAGTCGTCGTTTGAGCGCGATGAACTCCATCGTCTC
CGGGTCGCTAGTGTTTGTTGCCATGCTAAAAAGATTCTGATCAACTCGATCTTGAGCCACACGAACGCGAGCATCGGCTGTTTTCGCCATTCTTTCGGTG
GCTTGCACTTGTCTAGAGTAGAGAGCTAGGTTTGCGCGCTCCATTTCAGCACGCTGCTGCCCGATGGGGCGCTTATCTTCTGCTTCTGTTTCTGCTGTTG
ATGTACCGTCAGATGTGCTACTCCCGATACCGTCCACAGATTGTAGTTCAGTCAAACATTCGACTGCCGTCCGCTTCCTGAGAGAGGTCTTCTTGGTGTT
TCCGTCTCGCCAAACGCCCCACTTTGGCGAGTCTTTCAAGATGCTCCAGCACTGCAAGAACCGGAATTTTCCGCTCTCAGCTTCGTACAGCTCCACAGCT
TGATGAATGATGTCCGTTGGAGATCTACCACTAACATCCAGCCGTTCCACCTGCTTGAAGCAACCGACAAACTTCGACACAGACCGCGAAATTGTCTGGA
AGCGCGACTTCAGCGAGCCAGGATTTCTCGTAGTAGGAGTCCCTAGAATTTCTTCAAACACCTTTCTCACCTTGTGATACATGTCGTCTCCGGTCTGATT
GATCCCAGTTGGAGGATCACAGCTAGCATTCAGCCATGCCTCACACAAAGCCTTATCCTCTGCAGCACTGTAGTTCGCTCCTCGTTTCTCGGACATCTTG
CAGACTGTTCACCACTCCGCTGGTGCTATTTTCAGAGACAAATTTAGCTCTAGATGTGGCCCCGATGGCCTCAAAGCTAAATCTGTTTAGCTTTTAGCCG
CCCCGGTGGCGCTGTGCAATGCTATCCTAGTGCCAAATCTGGCATTTTGGGGCGCTAACAGCACCCCGGTGTGGTCACTCTTAGAGTTTGTAAGGATCAA
GCTTGG