Description :
From Genome Similarity Track
Location :
Scaffold_159:3082- 4944
Transcript NameFunction/comments
g7838.t1hypothetical protein
g7839.t1XP_009532708.1 hypothetical protein PHYSODRAFT_249081 [Phytophthora sojae

Sequence
1862 bases(100 bases per row)
TACAAGCAATGAATCAGCTGTGACGACTCGCGCACGCACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGAC
AACGAACATCATGCGCAGGCCGGTCCTGCAGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGCCGACAAG
CCGTAATTCGGTTTGTCCAAGATGCAATAGCAACTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACCGGCAGGGGAAACACAAATGAATTTAAAAT
TGGCTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCTTGCTTGCTCCGCGCTTCATTGGGCCATTCACC
GTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGC
ACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAGAGCCTCGTCCCGACCTCGACCTTTACGTTC
GAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCA
AGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCCCCCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGC
GAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGAATTCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATGT
CCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTA
CAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGA
CGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCGGGGTAGCAGTACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCG
ACAGCACCATGGTGCAGTCGTTCAAGTTTACCACGGTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTCT
TGTTGAGGTTTTCAACAAAGGCACTCCAACTCTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAG
CTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTCATCGGATCAAAGTGTAATCGCTTCGCGACGTCATCGTCAACGATGGCGTTGCACGAG
TACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGCGCGAGG
CCGCAACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTT
CGAGCTCGAAGCGTTCGAGTCGTCCTCGCGTGGACGACGTAGACCCACATTGGGGTCAGTGTGGCCCGGAGACAAGGATACCTTGTCTCCTTCGAGTTCC
CCCTCCTCGACTTCGCTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATGCC