Description :
From Genome Similarity Track
Location :
Scaffold_170:30815- 32647
Transcript NameFunction/comments
g6171.t1hypothetical protein

Sequence
1832 bases(100 bases per row)
CTGCCTATTTTCCAGTGTCGTGAAGAACTGCTGCAGGTGATTCGAGAGAATCAGATTGTGGTGATTGTTGGAGAAACTGGGTCGGGTAAAACCACGCAGT
TAACACAATACCTACACGAGGAAGGATACTCTAAGTTTGGCACCATTGGATGCACGCAACCGCGTCGTGTTGCAGCAATGTCGGTGGCCCAGCGTGTCAG
TGAGGAAATGGATGTGACTTTGGGTGACGAAGTGGGTTATGCTATTCGATTCGAGGACCTTACGTCGGACAAAACTATTATCAAGTACATGACGGAAGGT
GTGCTGTTGCGTGAATCGCTGCGTGAGTCAGACTTGGATTCCTACTCGTGCGTGATCATGGACGAGGCCCACGAGCGAGCTCTCAACACGGATGTGCTCT
TCGGTATCTTACGCAAGGTAGTCCAACGTCGCAGCGACTTCAAACTTGTTGTGACGTCGGCTACGTTAGATGCTGACAAGTTTGCCGATTTCTTCGGTGG
TGTGCCCATGTTTACCATTCCTGGCCGAACGTTCCACGTAGATACGCGGTATGCCAAGTCACCCAATGACGATTACGTGGACGCTGCTGTGAAGCAAGTA
ATGCAAATTCATTTGTCGCACCCGCCGGGTGATGTCCTGGTGTTTATGACAGGTCAAGAGGACATTGAAGCTACCTGTTACGTGCTAGCGGATCGAATGG
GCAAGCTAGACGGTGCACCCCCACTCATGGTTCTTCCCATGTACTCTCAGCTGCCCGCAGACTTGCAGGCAAAGATTTTCGACGCCTCCGACGTGAGGAA
ATGTATTGTCTCAACGAATATTGCCGAGACATCACTTACTGTGGATGGTATCAAGTACGTTATCGATGCAGGATTTTGCAAGGTGAAGGTGTACAACCCT
AAGATTGGAATGGACGCGTTGCAGGTTAGCCCCATCAGTCAGCAAAACGCCAATCAACGTGCTGGTCGTGCTGGTCGTACAGGCCCCGGAGTGGCCTACC
GTTTGTACACGCAGCGACAGTTCGTCAACGAACTACTTGAAGCGCAGATTCCTGAGATTCAGCGAACGAATTTGGGTTATGTGGTGTTGTTGCTCAAGTC
GCTGGGAGTCTCCAACCTGCTGGAGTTCGATTTCATGGATCCACCGCCGCAGGATAACATCATCAACTCCATGTACCAGCTTTGGGTCTTAGGAGCTCTG
GACAATACTGGTGAGCTTACAGAAATTGGCAAAAAGATGGTGGTATTCCCGCTGGACCCACCTTTAGCCAAGATGTTGCTATTCAGCGAACAGCTTGGCT
GCTCTGCCGAGGTGCTTGTAGTCGTTAGCATGCTGTCAGTTCCAAGTGTGTTCTTCCGCCCGAAGGATCGCGAAGAAGAGAGCGATGCTGCCCGCGAGAA
GTTCTTCGTGCCTGAAAGCGATCACCTTACACTGTTGAATGTGTATCAGCAATGGGAAGCCAACCGCCACTCAGCCCAATGGTGCTCCGATCACTTCATT
CACGCGAAGGGCTTACGTAAGGCTCGTGAGGTGCGCGAGCAGCTTGTAGACATTATGAAGCAGCAGCATGTGCGCCTTCGATCATGTGGTGGGCGCTGGG
ATGTTATTCGTAAGGCAATTTGCTCTGCGTACTTCTACAACTCGGCGCAAATTAAAGGCATTGGAGAGTACGTAAACATGTTGACGGGCATGCCGTGCAA
CTTGCACCCCAGTGCTGCATTGTTTGGGCTTGGTTACACCCCGGATTTCGTTGTGTACCACGAACTCATCTACACAAGCAAAGAGTATATGCAGTGCGCT
ACGGCTGTGGAAGGTGAGTGGCTTGCAGAGCT