Description :
From Genome Similarity Track
Location :
contig_55:30814- 33025
Transcript NameFunction/comments
g10938.t1hypothetical protein

Sequence
2211 bases(100 bases per row)
CGCCCAACGTGGCTGACTGCGACATCGCAAACGATAATGCGATCTTCTCAGTTACTCCAGCGAGCAAAGCACAATGGCATCTTTTGCGATGCTGGATCGG
TCCCCGTAGCTGAATTCCATGTCCTGAGCGTCAACTTGATCCATCATACCAGACGAAAACGGCGTGACCATCATAAGACGACGAGCTTCTTCCTCACGTG
TGAGTCCCCAAAAGACGCAGCAGCCCGTGCTGCACAACGATATAGCAACAGCAACAAGAATGGATAAGCAATGCAGTGTAAGCTAATAATCCTCCATACC
AACGAGTAATACAGAGCCACAACTTACGCAAAGATGAACACGTGCTTCTCTTGAAGTGCTGCCGCCCGTTGCGTTGCCCAGGGATCTCCATTATCCGTTG
CCGTACTTTCATATTGTTCTGGGGTGACGCTCGAGTGCAGGACTTCCAGGTATATTTTATTCTTCCACTTGGCAAGTCCAAGACCAATTTGCGGCGTCGT
TGAGCCTTCTTCCCTTTTCACGTCTTCAGCTTCAGCGCGGCGACTGTCTTTCACCTCTTTTTCCATCCACTTGAGCAATTTGAACAGAACGATCTGCTCA
CACGTGTAGTAAACTGCTACACGCCTTTTATCAGTGTGCGTTGGGGGCAACGGAGGCTTAAAAAGATGAGCTCGTGCCAGTTCTTCGTCGTAGTCCGGGG
CGTGTGCACGCCACCTTCTCCCACTTGGTCGCCGAGCCAACATCCCCAAAGGAACTCCATTGAGTCGGTGGATCTAGAGACACAGCGTCAGTCTCCATCA
AGTATGAAAGACCCGTTTCACTACTCACCGGTCGCTCTTTGGCTTGTAACCCGACTCGACGAGCTTTGGCGACAGAGAACCCGATAGCACGCACAGGAGT
TGAAGGCCCTTGAACATCTTGTCGGGAGACTTTGGAACTTCTGGGACAGTTGCAAGGGGGCTGTGAGCACAACAATTGGGATCGGTGGCGACAGATAGTC
GCCATCTTCTCCGTCGTCGCTATCATCGTCCGCGTCGCCATCGTTCGGAATATATCTTGGAGAGAAACTGGGATCGCAGCTGCTACGGGACTGAGTCTGT
GTCGAGTACGGCGACGGCGACGAGTTGGTTTGGAGACACCCGCAGAGATCTCGATGTTTGGCGAGGAATCCTGCATCTGCATTGAAGCACCTCAATGGGT
CGCGCAATGAATGGTCACCCCTTACCGAATATTCCCTTTCAGAACCGACCATTACACCAGTATCCCGTCTACTAACCTCTCAACAGGCATAACTCGCTCC
TTCTGTGGCATACATAATCCGGATTCCTCCACGACATTTTCAAGCTCAAAGTCAAGTTCGACAACTCACGGCTTGACCATTCGAGAAACAGAGTCTTGTA
GTGGATCGTCTCGCTTTCGTTGGTTCAAATCTGATTGCAATATGGAAGGCGAAATGATCTCCCGAGGTCCATTGTTGGCAATTGTGCTTCGCCACTGGTT
AGAGACCGATACTCTATGGATACGACACGTTGGTGAAAAGTGTCAAGCTCTCTCGGTCCGTCTCATAGCATGTCGGTAAGTGAAGCTTGTTCTTACGGTT
CCATCGAGTTGTTGAACTGGATTTGGGACTCGAGCTGTGTCTCCATCAGGTCAGCTGGGCGTCCTGCAATTTCCTGCGGTCAGCGACTTACTACAGTCGG
TGGTTAATTCCCGAGGCATTGGGAGTAGCAGCGAAGACGGGGAGTACCAATGCAGGGCAGTGGATACTGGACCATTTTTTCCCCAGAGTGTGAAGGTTTT
GCAGAGATGGCTGCTGAGAATGGCCGCCTTCACGTGCTACAGGCTCTGCTCCAGCATAACGTTACCAATCCGATTGATTGGGGATATGCTATGGTTGCTA
GTGTTTCCAATGCCCACTGTGACGTGGTGAAATGGCTCTGCACAAATGTTGTCCACGAATGCGAGCTTGAGTCCGTAGTTTACGTAGCTCTGAACCGAGG
CGACATGGATTTCGTGACGTTCTTGATGCCCCCGGTGGTTGTATCTTGGATCATGCCTTGTCTTGTAGCAGACCAGAGATCATCGAGCTCGCCCTGGACT
GCGGCTACTTCCATCGCAGTGAAAACAACGCTACCTTCGCCGTTCAAAATCTGGCCGAAACAGGGAAACTGTATGTCATGAAGAAATTGCACAGCAGCAC
AATCCACCCCC