Description :
From Genome Similarity Track
Location :
contig_55:30810- 33021
Transcript NameFunction/comments
g11450.t1OWZ01289.1 hypothetical protein PHMEG_00027357 [Phytophthora megakarya

Sequence
2211 bases(100 bases per row)
TCGAACGCGCCCAACGTGGCTGACTGCGACATCGCAAACGATAATGCGATCTTCTCAGTTACTCCAGCGAGCAAAGCACAATGGCATCTTTTGCGATGCT
GGATCGGTCCCCGTAGCTGAATTCCATGTCCTGAGCGTCAACTTGATCCATCATACCAGACGAAAACGGCGTGACCATCATAAGACGACGAGCTTCTTCC
TCACGTGTGAGTCCCCAAAAGACGCAGCAGCCCGTGCTGCACAACGATATAGCAACAGCAACAAGAATGGATAAGCAATGCAGTGTAAGCTAATAATCCT
CCATACCAAGGAGTAATACAGAGCCACAACTTACGCAAAGATGAACACGTGCTTCTCTTGAAGTGCTGCCGCTCGTTGCGTTGCCCAGGGATCTCCATTA
TCCGTTGCCGTACTTTCATATTGTTCTGGGGTGAAGCTCGAGTGCAGGACTTCCAGGTATATTTTATTCTTCCACTTGGCAAGTCCAAGACCAATTTGCG
GCGTCGTTGAGCCTTCTTCCCTTTTCACGTCTTCAGCTTCAGCGCGGCGACTGTCTTTCACCTCTTTTTCCATCCACTTGAGCAATTTGAACAGAACGAT
CTGCTCACACGTGTAGTAAACTGCTACACGCCTTTTATCAGTGTGCGTTGGGGGCAACGGAGGCTTAAAAAGATGAGCTCGTGCCAGTTCTTCGTCGTAG
TCCGGGGCGTGTGCACGCCACCTTCTCCCACTTGGTCGCCGAGCCAACATCCCCAAAGGAACTCCATTGAGTCGGTGGATCTAGAGACACAGCGTCAGTC
TCCATCAAGTATGAAAGACCCGTTTCACTACTCACCGGTCGCTCTTTGGCTTGTAACCCGACTCGACGAGCTTTGGCGACAGAGAACCCGATAGTACGCA
CAGGAGTTGAAGGCCCTTGAACATCTTGTCGGGAGACTTTGGAACTTCTGGGACCGTTGCAAGGGGGCTGTGAGCACAACAATTGGGATCGGTGGCGACA
GATAGTCGCCATCTTCTCCGTCGTCGCTATCATCGTCCGCGTCGCCATCGTTCGGAATATATCTTGGAGAGAAACTGGGATCGCAGCTGCTACGGGACTG
AGTCTGGGTCGAGTATGGCGACGGCGACGAGTTGGTTTGGAGACACCCGCAGAGATCTCGATGTTTGGCGAGGAATCCTGCATCTGCATTGAAGCACCTC
AATGGGTCGCGCAATGAATGGTCACCCCTTACCGAATATTCCCTTTCAGAACCGACCATTACACCAGTATCCCGTCTATTTACCTCTCAACAGGCATAAC
TCGCTCCTTCTATGGCATACATAATCCGGATTCCTCCACGACGTTTTCAAGCTCAAAGTCAAGTTCGACAACTCACGGCTTGACTATTCGAGAAACAGAG
TCTTGTAGTGGATCGTCTCGCTTTCGTTGGTTCAAATCTGATTGCAATATGGAAGGCGAAATGATCTCCCGAGGTCCATTGTTGGCAATTGTGCTTCGCC
ACTGGTTAGAGACCGATACTCTATGGATACGACACGTTGGTGAAAAGTGTCAAGCTTTCTCGGTCCGTCTCAGAGCATGTCGCTAAGTGAAGCTTGTTCT
TACGGTTCCATCGAGTTGTTGAACTGGATTTGGGACTCGAGCTGTGTCTCCATCAGGTCAGCTGGGCGTCCTGCAATTTCCTGCGGTCAGCGACTTACTA
CAGTCGGTGGTTAATTCCCGAGGCATTGGGAGTAGCAGCGAAGACGGGGAGTACCAATGCAGGGCAGTGGATACTGGACCATTTTTTCCCCAGAGTGTGA
AGGTTTTGCAGAGATGGCTGCTGAGAATGGCCGCCTTCACGTGCTACAGGCTCTGCTCCAGCATAACGTTACCAATCTGATTGATTGGGGATATGCTATG
GTTGCTACTGTTTCCAATGCCCACTGTGACGTGGTGAAATGGCTCTGCACAAATGTTGTCCACGAATGCGAGCGTGAGTCCGTAGTTTACGTAGCTCTGA
AACGAGGCGACATGGATTTCGTGACGTTCTTGATGCCCCCGGTGGTTGTATCTTGGATCATGCCTTGTCTTGTAGCAGACCAGAGATCATCGAGCTCGCC
CTGGACTGCGGCTACTTCCATCGCAGTGAAAACAACGCTACCTTCGCCGTTCAAAATCTGGCCGAAACAGGGAAACTGGATGGCATGAAGAAATTGCACA
GCAGCACAATC