Description :
From Genome Similarity Track
Location :
contig_16:30805- 33779
Transcript NameFunction/comments
g3547.t1hypothetical protein PHMEG_000245
g3548.t1hypothetical protein

Sequence
2974 bases(100 bases per row)
GAGCTGCTTCCTGCCCTTGATATAGAGCTCGTCCGCTTCCTGGATGGATAGCAGGTGCGCCTGGTGCTGCAGCGTCTGGTGCTTGAGCGACGGCCCCGAG
TCGCCCAGATACCACGGCCGTTTGCTGATGAACTCGGGGTTGTGCGGGTTGATGAGGTTGCCCCCGCATCCTGCTCGGGCGGCAGCGTACCGTTCTTACG
CGCTTCCTCGATCTCTTGCTTCTTCTTAAAGTCGCTGCTCGACAAGCGCTCTCCACCGGCCGACGCCATCTCCGCTGGTCCTGCTGCTTCCCCTTTTTGT
ATTGGAACCCGCCACTTCGTTTCCGATTGGCTGAAGCAAAATATTTCAACCAATCGAATGCCGTTTGACCAGTGCTCAGATTATCTCCACATGCGAATTT
GCGTCGAAGAGGGAGAACGAGAGTGATTGTCACGTTCCACCGGCGATGATCTCGGAGGCGGCGCACGCCGAGTGCGTGCGGCTGCTGGAGCTGCTGACGA
ACCCGCGCGTGCAGGAGAGTTGGTCGTGGGTGTTCATGACGCCCGTGGAGATCCCTGGCTACGAGCGGGTGATCAAGCGCCCCATGGACCTGGGCACCAT
CAAGAAGAATTTGGGCGTCAAGCCGTCGCGCTGCCGCTTCAAGTCGCACGAGAAGTTCGCGAGGGACGTTCGACTAGTCTTCCAAAACGCGCTAGTTTAT
AACAAGGCCGACCAGGACGTCAAAGGGTCCGTTTACGCGGCGGCGCAGCATCTGCTGCGGGTCTTCGAGACGGCCTACGCCAAGGCCATCGAGAGCGTCT
TCAAGGCGGACGATGAGGCCAAAGCGGCCCACCGAGAGGCTAAGAGGAAGGCCGACGGAGACGCAGAAGGTGCGGGCTCCTCCTCCTCCTCCTCGCATCA
TCACAACAGCCATCACAGCAGTAACAGTCACCGTCGAGAAGAAGGCGAGGAAGGCAGCAAGCACAGACACAAGCACAGCAAGAAGGAGAAAAAGTCTAAA
AAGTCCAAGAAGAAGAGCAAGGACAGAGAGCACAGGCACTCGAGCTCCACCAGTGGCGAGAGCAAGAAGAAATCTCACCGCAGTGAGCACGAGAGCGGTG
GCGTGTCTTCCAGTGATCTATTAACAAAGGAGACATCCAAGACTGTCGTGGCGGCCCCTAAGAGCGAGTCGTCCATGCCGACAGCTAGTTATGCAGCTAT
TCCACAGAGTAATAGTGTGGTTGTGAAGCGAGAGGTGGTGCAGAGCCTCTTGGCTCCTGGAGAAAAGATGTCGGACGCGGAGGTGACAGAATGCCTTTCG
CTGTTGATGAAACTGGTCAAGTATAAGGAAGGAGCAATCAGTCCTGCTGCGCCGTTCCTACAGCCAGTGGACCTGACGCATTTCCCGGACTACCGCGTCA
AAGTTCCGAACCGAATGCACCTGTATGGCGTCCAGAAGAAACTTCGTAGCGGGAGTTACGGTACCATTGATGCGTTTGCCTACGACATGCGGTTAATTTT
TTCGAACTGCCTGGTGTACAACAGCGACGTGATTCTGAGCAAAGTGATGCGGAATCATGCCGTCACCCTTATGAAGCTCTTCGAGACCCAATTTGCTAAG
ATTGGCGGCACATGGCCAGGTATTTCAGAACGGTGGAAATGCCACCAGATCATCCATGAAATCCTTGCTCACCGCACGGATGGGCAGGAAACAGCGCAGT
GGTTCAAATATCCAATTGAGTCGTACTATGATTCACCGGACCAAATTCCGTACAACTACTACAAAACGGTCAAGGATCCAATGGATATCGGCACAGTGTC
GAGTAAGCTACATCTGGGGGAGTACAAGCACGTCTCAGAATTTACGGCGGGCATGAAATTGGTTTTTGACAACTGCATCCGGTACTGGAGGCCAGATCCC
CAGGGACAGACGTACTGTGAGTCTGCGGAAACTTTGCTTCGCGTTTTGCACACACGAAGCGCTATATTTGCTTCTTCCGTAAGCAGTTCTTCGTCAAGAG
AAAAACAACGATCCTTTTCGTCATCGTCGTCGAAGGTCAAGTCTGCCCCTGCTGCTACACACTCTTCCACTACACAACTGTCATCAGTTTCCGTGGCTAG
TACATCTGGAGGGGAGCATGAGAAGATCAAGAAGAAGTCGTCGTCGTCGAAGTCATCCAAATCGTCAAAGCCATCAAAGACTCGGGAGGCCAGCGGAGGT
TTGCCGGAAAAAGATATCTGCTTGGGTATAATGAAGCAGCTGCGAGGGCACAAGATGAAGGGTTTCCGTGGAATCGAAATCAAAACGGCTGGGCCCTTTT
TGACTGCTGTCGATACAACCAAGTACCCGGATTACCTGACAATTGTCTCGGAGCCCATGGATTTCGCTAAAATCGAGCGCAAATTGAAAAGCGATCGGTA
CGGCAGTGTCGACGAGTTCAGTGCCGACGTCCACTTGATATTCTCGAATTGTCACAAGTACAACAGTGACCCGGTGGAAGGCGCCGACATCCGAGCGATG
GCCACAAACCTGCGCAATTACTTTGTAGAGCTTTGCAACGAGAAGCTGGGTCCTTTGGACGGCATGGTAAATGGGCCGATTCAAACGCCAACCCACTCAG
CCCAGGTCGCGTCAGCATCATCGTCTCTTGGTGTAACTCAACCCAAACCAGTGGCCCCAACATTAACGCGTGCGCCCGAAGCTAAAGTGCATAGTGCTGG
AACGGGGTCTTTATCTCTCCACAAGCCAATGAAAAAATCCCCCGTCCCCTCTCCGACCAAGAGACCGGTGTCGTCTGCATCTGCGGCCGTGTCCAGTAGT
GCTGTCTCCTCTCGTGACCTGAAAAGGGAAATGGAATCGTCTCGCAGTAGGGACTCCCTGAAGACAGAGCCTGTGGGCGCTTCAATAGCAATTCCAGTCG
CTTCGCTGAAGCCCGTTGGTCAAGTGAAGGCAGTGCCTGTGCCAGTCGCCGCAGTCTCTTCATCTACGATGAGT