Description :
From Genome Similarity Track
Location :
Scaffold_1:308040- 312921
Transcript NameFunction/comments
g98.t1XP_009515490.1 hypothetical protein PHYSODRAFT_343758 [Phytophthora sojae
g99.t1hypothetical protein

Sequence
4881 bases(100 bases per row)
CACACACCAATGTGGACAGTCGCAGCACAACAGCACAACCTGAAAATTGTTGCTGTCCGTCAGCAATCGCAAAGACTGAGCGCTCCGCTCGGCTCAGCAG
TGAGGGCGGACCATGTCGACGAGCAAGATCGACGCTCAAGGCGACAGGCACAGCAGCGTAACGAGCCACGTTGCCTGCGACTTGCTGCGAAACGGTCAGC
GGTAGCGGAGCCCGTGCTGCTGGAAGCTCGCCATGTTCTTGGCCAGCGATGATAGCTTGGGCCGTGCACGCACGGGCGGCCATTCCCTATGCTGCATGAT
CGTGGGACCGGCGTGCTTGCCACCGAGGCGCTGGCTCCACCGAGCTCGCGATCTCGAGCTCGTGCGGCTTCGAGGACGATTTTCGATAGCCTGCTTGCTT
GCAGGCAGCAAACGGCTGCAACCAGCACGTGTAGCCGGAGCGCACGCGAGTCGGTGTCGGCTCGAAAGCGAGGCTGGCGCGTAGGAGAAGAGTGCACTTT
GCTATCAGCCCTGGATTGCGGCCTGTGCTTGCTGGCCTGTAGCAGGCTGCTGGTTCAGTGGCTCCAGTTTCAGTAGGAAGGAAGTACACTTGTAACGTGC
GCAACTTGTGTCTTGACCCCTGAGCCCTTGCGCTTGAAACATCATACAAACCCCAGGTGGCGCGGTGGTCTCGTGGGCTTTGACGCTGTCGTGGCGACGC
AAACGGGCCGATTTCGCACGCCTCGACCGGTCGCATATCGGGTGGGGGAGCCCAGCACTATCCAGCGTCAGCTCGTGCGTCCGCAGTCGGTCTTTCCAGC
CAACCGCCCCACGTCAACTCTCAGAGGCGACGTACACAACCCCGCCCCTTGCAGCCCGAGCTGTTCGTTGTACCATACCCCCTCCACGCCGGCGACGCCT
GTCCAAAGCGCGGAATTGCGACGCCACTGCAGTGCGCCATTTAGCGTAGCGTAGCGCAGGAACCGGACGCAGGACAGCCCAGCCCAGCCACCAATGAGCT
TGTTCCAGAGCGGCGTGCAGGTGTTCATCCCGGCGGCGCTCAACCGGCCCACGCACACGCTGTACAGCATCTGCATGCTCGTGCAGCCCACCAACCAGGA
GTGGACCGTCAACCGCCGCTACTCGCAGTTCCTGCAGCTGCGCAAGGACATCCAGCACAAGCTTGCCACGCGCGGCGTTTCGTGCGCCAACTGCGCCAGC
TTTAACCGCGCCATCAGCAAGTTCCACTTCCCTAGCAAGTCGCTGCTGCGGACCAATTCGGTGGTTCGCCACCGCGTGTCGGCGCTGCAGGAGTTCCTCA
AACTGCTTGTGGGGCGCCTATACAACGACCTCCCCAAGTGCGGCATCTGCGGCGAGGAGATCAAGGACTTAATGCGCCCGTTTCTCATTCGAGGCGCGCA
GCCCATGAACGGCTCCATCCTCCCCAAGATCAATAAGTCGCTGTCGCTCGATTCGTACGCGGTGGTGGACCAGCCGGTGATGCCCGTCCCAGAGCCAGCG
CCGCCCATTTCTCCTTCGTTGGTAGGCAAAGAGCTCTTCAGCGCCAGCAAGTCGTCGAGCAAACCCATTTTCACAAACAGTCAGGTCTCGGGCGGCACGT
CCATCTTCTCTCGCAACAAGGCCATGATGAGTACTCGGTCGGACGATGCATCCACGCAGCCTAACGAGTCGGAGGACCCAATCATGGATTATTCAGACAG
TAGTGACGACGATGGCTACGGCAAGAAGTACGATGACGAACGGTGCTACGATGAGGGCATTCCTCTGGAGGAGGCTATGAAGCAGGTGGTGGTGCCCGAG
GGAGCTCGCCTTACGTGCGAAGAAGTGGTTGTCCGGCTCACGTCGATGTGGGCCTCGTTCGATCTGGAGGAGGCACTTTCATCCTTGCCAGCCGAGCGGC
TATCGCAGCAAGCCAACTTCTCTGTAGACGACAAGGAATACGCGTTTTGAGTGTGTTGTTGGACAGTGCAATTTTGCTTATCCACTTCGAGGGTAGCTGC
TAAGCCGGCCAGCAGAGCCGCATCGCCCCGCGGGCAGGGTGCTGTGCAAACTAAGTATGAAGCAGTCAGTATATTATCAATGCGATCAGCACACACGGGT
AATCGCGTTTAGCATTGACTTTATGCATGCTTACTCAATCCACACGTCACTGAGGTTCACTTTTCGCTTGTTGGTTCGACTGCACTTGCTCGCGATTCGG
TGTCTATAACTTTTCGGGGTCGGCGATGCCAGTTGCGACCACGGAAACGCGGAGCTTACCGTCGAGGGAGTCATCGAACGTCGAGCCGAAGATAATGTTG
GCGTGTGGGTCGTCAAGTTCCCGGGTCACACGCTCAGCAGCTTCGTCAACTTCAAATAACGTCAGGTCGGAGCCACCTGTGATGTTTACAATCATGCCCT
TGGCGTCCTGCCGACGCAAAAGAAGCACGTGAGCAAGACGAGCACGGATTAGCATGTACACGTGAGGAATTACCTTGATTGAAATGTCTCCCAGTAGAGG
ATTCGCCAACGCATCCTCAGCAGCGCGCAAAGCTCTAACAAACGAGCGCAACCATAACACTTTAGCTGATCCAATTTCATCTCATTAGCAGCCAGCCAAT
ACACAAACCCACCGGTTGTCTCCATCGGCCTCTCCACTTCCCATCATGGCGTTTCCCATGTTTTGCATCACCTGTGGTTGAGTGTCAAACAAAGCAATGA
GCAAGTCGCTAACCAGATTGTCACCAAAGGAAAAGTAAGAGCCATACCGACTGCACATCCGCGAAATCGAGATTAATGAGTCCAGGCATCACCATAAGAT
CAGATATGTTCTTGACGCCATCAAGGAGCACATTGTCCGCCATTCTAAGCACATGTACCAGGCACGCAGCAACCGTCAGCTTCACTCAGCTGAATCGCAA
TGTAAATCCTCATCCAGGAGTGATAGGCCATGCCACGCACCTGAACGCATCCATCAGTGACGTTCGTTCGTTCGACATGTTGAACAGATTCTGGTTCGGG
ATCACAAGCATCGTATCCACGCTATCCTTCAGCTCAGCGAGACCTTGCTCCGCAAGTTTCGCACGGTTGCTGCCTTCAAACCGGAACGGCTGCATCCCAC
CAAAGGTTGCAGTTAGTACAGAATCGTCGTGGACAAACTCATAAGGTCGTCAATGGAACACACCTTCGTGACCACAGCCACCGTAAGAATGCCAGCATCG
AGGGCTGCTTGAGCAATAATGGGGGCTGCACCTGTACCAGTTCCACCGCCCATACCCGCAGTAACAAACATCTATTTGACAAAAAATACATATGGGAGTA
AGTAAACGCGTTATGGCCGCATTCCAGTTTCGTTTGCTTCAAGATCTGTTTGTTCAATAGCACACACCATGTTTGCACCTTGGACGCGCTCCAGAATCTC
ATCAATCGCGGCCTCCGCTGCTTCCCGGCTATATCGTCCACATCGTTCAATTCAGCACGTCTGGAAAATACCTCTACCAAATTATCCGCCTAGGAGCCAA
ACACGTACCCAACTTCAGGGTTGGCACCACAGCCCAGTCCCCCCGTCAGCTCAGGAGCCATCTGAACACGGTTCTCTGTCAGGGTCGTGCGCAAGTGCTG
TGCGTCCGTGTTGCAGACCAGGAACTCCACGCCCTGCAGGCCGCGCGCGATCATGTTGTTCACTGTCAATAAACATACCAACAGATATCAATCACCCTGT
GATTGTCACACTCATGAGCTGAAGTCCACACCTGCATTTCCTCCAGCCCCTCCGACACCGACCACCACGATTTTCGGTGCAAAACCCGACAGGTCCGTCA
CCGGGTGGTCCTGCGTGAGCCACAACGGCTGCGTGGAGCTCATCGTAGGCGGCACGAGCTTCTTCTCCACGACCGGCGATGGCGCGGCGCTCACATCCGT
CGGCGAAGCAGGCTCCACCTTCGCTTCAACGTCCACTTTTAGAACGTCGTCTTCATCTTTCCGAGCCTTCTTGAAGCCCTGTAAACACAGGGTCAGTGGC
CGATTTACGATATAAAGGCATGTTTTTGAAATTGCGAGCGTTTTACCATGCGCAATGCCGCAGCGGCCGCATCTGTGGCTTCGGTAGAGAAGGCAACACG
CTGGTTGGCAGCATAGTTAACCCGGTTGGCGCGTAGAAGCGCCGTCACCGCGGCCGTCATGCGGAAAATCGTCATCGGAATTGGGAACACTACCAGATCG
CCACAAAATGTGCTCGGGGTCACTAATATGCAACGATCACAAAGAGTAACACGAAGAGTATCCCATTCGTTTTTATAACATGTAAACGCTTTTTAAAATG
AACAGCGATTAAAACGAAACGATTTGTTAAACAAAACAATATTTAACTGTTGAAACAGTGGTTAAATCGTAAATGCTGCCATTTCGCTAACCTCGCTGTC
GGCGGAGGTCCTCCACGTTGGCCTTGATGTACAGCAGCACTTCTGCCTCTGTCAGATCCAATTGGACACCGTAGTTGCGTCCTACGAAAGTGCTGAATTC
GTCGACGTCCGAGCACAGTAGCCGTCCCGTGTCGGTCCATATTACCACGTCGCTGATCACGAGGTTCGAGGAGGTGGGCAAGTTGAAGCTGTCTTGCCCA
AATGTTAGAATGCATAGCCATCGTCCAGATGCAGCGGACCGCAAACTTACCCGTACAGACGCATTAGCTCGGCGGCATCGTTAGCCCAGCGATCGGTTTT
GGACGGCAACTTGGTCACTTGGCAATCAGGCAGCGTCGCTGCCAAAATGTCTGCACAAACACCGGAACAGTTAGACGCATGCAAGTGATCAACACGAGGA
GGTACATTCGTTACCAAGCAGCCTGTCGCAGATAGCATACTCCTCACTACTTACTCGCCCAGCCAGCGTGTAGTGCACCAT