Description :
From Genome Similarity Track
Location :
Scaffold_936:308- 4598
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_936-fgenesh-gene-0.1Voltage-gated Ion Channel (VIC) Superfamily
Pytve_DAOMBR484maker-pve_contig_936-fgenesh-gene-0.2Alcohol dehydrogenase

Sequence
4290 bases(100 bases per row)
GCACGATCAGCCGCTTCATGACGAGCGCGAACTCGGGGAAGGCGTCAAGGATCTGCTCCAGTCCGTCCCGCTGCAGGATGCACAGCTCGGCCATGCTCTC
GGCCCGCACGCTGCGTGTGCGCTGCACCTGCATGACGACGCCGATCTCGCCGAAGAAGTCTCCCTCTCCGAGCAGGATCTTCTTGTCTGGCCCCGGGTCA
ACACCGCCTTTGGGAGGCATGACGTGCACGACGCCCTTGACGATCAGGAAGAGCTCCTTGCCGATGTCACCTTCGCGAATGATGAAGTCGCCCGGCATGT
AGATGACCTGTCGCAGCTGCATGCAGATCATGCCGAGCACGGCGTCCGACGCGCGCTGGAAGAAGGGGATCTTGACCAGGTAGTCCTTGAAGAGGTAGAT
GGCGATCTGCTCGCGCAGCGAGAGCGACATGCCCTTGTCTTGCAGCAAGCTCAGCTCCTCCGAGAAGGCGCGGTTCTACCAGACAGACAACTGTCAGCAC
CAAGAGGACGACACCCGTCGATCTCATCAGAGTAGCCCACATTGAGCCAGAGGTAGTCGTAGTACGCCGTCACCCGAGCCTGGCACGCACGCATGAACCT
CAGGTTAGACCAGACGCGACGACAGCTCGGCACAAACATCCAACGTACGCGCATCGACTTGGGCAGACAGAGTGCCTCCATCTCGTGCGTCACGTGGTCC
ATGCGCTTGCGGAACGCGTTCTCGGCGCGATTCCAGCTGTCCACAGCCGTCACACAGTGCAAGCAGTGTCAGTCGAGCGAAGCCTCCGATAGGAACCACC
TTCCCGACCTCTTGGCAAGGCTGATGACCGTGCCGTTGAGCGCGGCGGTGAGCACGGCGCCGGCCACCGCCACGCCGCACGACCACATATAGACGTGGTT
CGAGCGGTTCTGGCTCTGACCGACGGCGTCCAGGAAGTAGGCGTCCTCGTCCACGTGCGCGGTCGAGATGCCCAGCAGCGAGACGATGCCGTGCTGGAAG
GCGATCCAGTAGACGTGGACGAGCGCGTCGCTGGTGCAGTAGGCCTCCGCCAGGGACGACGTCGGAGAGTCGCACGGCCGCAGCATCGCGACCCAGAGGC
AGGCGCCGACGTGCGCGCCGAAGAGCACGGCGTTGAGCGCGATCGTGAGACCCGAGTACATTTTGTACTGGCGCACGTGCTTGACAAAGCGGCCGATGCG
CAGCAGGCGCGGCAGCTTGAAGTACTTGATGACGAGCAGTGTTTTGGGGGTCGCGGCGCTGTCGGTGTTGCGCACGAGCAGGTCGAAGGGAACAGACGCG
AGCACGTCGATTGGGAGCCACACGGAGCGCAGGTACGCGCGACTGATGATACGCGGACTCATATTGACGGCGCCGTACTCGATGACGCCCGTGCGGAAGC
GCAGAACAATGTCCAGCATCCCCCACACGTCGAGCATGCGCATGAACGTGGAGGACGCGCGCGACGGCTCGAACCACGTGAAGCCCAGCTGGAATGGCAC
CATCCACGCGTAGTAGATGACGCAGAAGGCTCCGGCGAGGTCCCACGCCGTCTTGTACGGCGACAGCGGGTGCAGCACCCAGCGGTGGCTCGTGCGGTCG
TGCACCTCCTGTAGCGAGCTGCGCAGGAAGTTGAGGTTGGTGGCGCTCATGCCCAGCATGGACAGCGTCCCTCCCGACCGCCGAGAGCGCGCGCTCCGGT
CGGCGTTGGCCGACACGCCCATCTTACGCCGTGCGAGGTCCGGGCGGTCCGGGTGGTCCGAGCTCGCCATGGTCTCAGCGATGTTCGGGTGCACGCGGTC
AGACGCAGAGCGGCCGCGCTGCCAGAACATGGCACTGGTTTCGAACCTGTGCACGAGCGTCGTCGTTGTGGTTCAAACTTGTGACACACGTGGGCGAACG
AGCGACGATCCGACGGTAACCACTACAGCGGACTCGAAGCGTCGTCCGAGAAGCTGTGACTTGTGAGGACATGCACGTTGAAGTTGAAGTTGCTGTCTTC
GTACTCAAAATGGGTTCTTCATGATGCGCCTACGCGCGTCTGACGTGTACACTCCTCCCAGCATCGACATCTTGTTGCAGTTGTGAGTTCAATGTATTTA
AAGGCGTAGTCTCAAACCACCGTGTTGAACAGTGCGCCGTGTTAATTCGCATAGGAGATGCAATGCTAAAGCGAGCAAGCCAGTTGTTGTGGACCCCCTG
TCATACAGCCAACATCTGCCTCAAGCTCACTCGTGTCGTCCGCAACGACCACCTCCAGGCATCTCGACCCTCTCGTCACGGCAGACTCTGGATTTTGACA
ACCACCTTGCCGATATTCTTGCGGGCCATCACGTATTCCAACGCGTCCGGAATGCTTGTGAGGCCGTCGAACTTGACGTCGTCGATTCCAGACTTCAGCT
CTCCCTTGGCGAACAGCTCCATCACTCTGGGACGGTGCTTCGCGAGGGGTGTCGGGTCTGCGGTGAGGCTGATGCCGCGGATAGATGCGCACCTCGCAAT
GAGCGACAGTAGCAGCGAGCTCAGCGACCCTTCGGTCTTCTTCGCTGAGTCTTTCTCGCCAGAGCCCGACATGTTGTTGTACTCCGAGGTTATTCCGAAC
GCGATCACTCGTCCATGCATGGCGAGGTGAGGCACCAGAGATACCAACAGCTCGCCGCCAACGCTGTCGAAGATCAGGTCGACACCCTGCGGGTACTCGT
TGCTCAGCACCTGGCTCACGTCTTCATTCGAGTAGTTGATCACACGGTCACACCCAAGCTCTCGCAGGAACTCGGCCTTCTTGTCCGAACTCGTCATCCC
GATAACCGTGTTTCCCGCTTTCTTGGCCAGCTGCACGACGTACTGTCCCGTTCCGCCAGCCGCCGCAGTGACGAAGACCGTCTCGCTGGACTTGATCTCG
CCGGCCTCTTGCAACGATGCCTCAGCCCATACTGCCGACGCGTACGACATGGCGTCGGCCTCGCTCGACGGGGTCTTCGTCACGACTGCGGCCGGTACCA
GCGTGTACTCGGCGAACGCGCCAGCGCCTGCACTCGATCGAGCAAAGAACACCATTCACGGAGTTAGGAGAACACTCTCAAAACGTTTGGGAATATGGCG
CGCGGTGCCAAGTTGCACTGCACGTACCGGTATAGGTAACGCTGTCGCCAACCTTGACGGATTCGACGCCGTCGCCAACTTGAGTCACGACGCCAACTAC
AGCAAGAGGTGTTTCGATCAGTGGAGCAATTGCAAAACGACGCCACGGCTAGCTAAGCGAACGCACTTGCTTCGAGACCGGCAGTGAACGGCAGCTTCTG
TTCGCCCATGAACATGAACTTGTTGGTGAAGACGAGCGTGTCGTACGCGGCGACGCTGGCGTACGTGTTCCGCACGACGACATTCCCTGGAGTTGCGCTT
GGGATTGGCAGTTCAACGACCTTGCTGGCCGTGCGGTAGCCGTTCGATGGTTCAAACACTTGCAGAGCCTTGTTAGTCGACATGATGTGACGGGTGTAGC
TGTAGTAGGTCGAGGTTTGCACTTGGTGGCGAATTCGATTGTGATCGATTGCCGGCATGTTGCAAGCGCACATTCGACGATATGCTATGAGGAAGCTATT
CTCACACGTAGTCGACATGCTTCGACCCGCTCACATAATCATGTTGGAGATCTCGAAGTGCTTTCGGCACATTTACACGGGCGATGAATTCGATTGGGAT
CAACTGCCAGTCTTTTGCAAGTGCGCCACCGACGATCTGCTGCGGGGAAGCTGTTCTCGCACATAATCAACGAACTTTGGCCCGCTTACATAATCATGTT
TATCTGATCTTGAAGTGCTGTCGACACAGTTGCACTGCATGCATAGATACGCATCAGATTGAAGGAGGAGGACACACAGACGCGCTCAAGTGGACATACT
GGCCATGCACATTAGCAACCCCTCCTCCACCTCATCGTGGTGAAAGCGAGCCTCATTCACGACGATGGTGTATCTGGAAGACGAACTCGAGCAGACATGC
AATGCGTAGTTGGCTGCAGCAGCTACGCTGAGCAGTGTCTTCTGCTGTCTTGCTGTTGCCAGCGAGCACAGTGGATGAGTTGCGTCTATCTGACGGACGA
TACAGTACGTTGCTGATCTCATGACCGTCGACTGACGAATGTGGATGGCATCGCCGATGCTTGTGAGGTTGGTCGGTGGAGAGCATAACGGCAGCCCGAT
GGTGTGAATCGCCAAACAGCACATACGTGAAGGTTTTGATCGAGTGTCACACCAACTGATATGCTGGCACCAGTCTCCAATCTTGGGAGA