Description :
From Genome Similarity Track
Location :
scaffold_1512:308- 1441
Sequence
1133 bases(100 bases per row)
TAGGCCCGGGTGCAATCCGAGAACTCCAGGGCTTGGTTCACCTTGCACCTCACCAAAGTATAGAGCGAACGTCTGCTTCCATTGCTCCACCTTGGTGCGA
TCTTCCATAAATTCCGGAAAAGCAGCCATGTTAGCTTCCAGAATTTCTCAAGGCTTGTTTGTGTTAATGTCTGTGCGTGGACTGTTGGACACCAACGACG
TCTGTACCTCCTCGGAAATGATCCAATTCTGAATTGGCAATTCATGAACAACTTTGCGGCAGCAGGGTGCTTGGCCTTTGAGAGGATGCCCACACGCTGA
CCCCAGCTGAGGTACTCAGTGCCATTGGTTACAAATGTGGTTGAGTTACCGCGCACACTGGAACCAATACCAATGGCCTTCTCCCCAGTACTGACTAGAT
CACGGGCAACGTTCGTGCCACGGTTGAAGCTGACGTTCTGCTGGGCCAATTGGGATATCCAGTCCCAACCATATTTCTCGACGTAGCGAGTATACAGGAA
CAACACTGCGTCATCGTCGTGTGGGTAGGACGAGGCGATCTTGCCAGCGTACTCGGGCTTCACTAGATCTGCAGGAGTGGTAGGTGGCGTCAGGCCATAG
AGTGCAGTCGTGTTGTAGATGAAGCTGAACTGGTAGATGGAGTACCCCAGCCATGTGCTGTTTTCGTCTTTCAGTGAATTGTGGATCTTGGAAAAGTTGG
CAGGTTTGTAAGGGGTGAGGACTCCATTCTTAGGAAGTCTTGCAATGTCTGCAATGCCACAACGTCGGGTACTAATGTGTCAGTTTCCAACTGGTTGTCG
ATACGGACGTCGTGGTACTTGCTGTAGTAGTAAAACTAAGTTTTGGAAAGCGCTTCTCAATGGCAGCGTGAAGGGTGTCCTGCGAGGTAGATGTGTCTCC
ACCATGATAGAGGACGAGGTTGCCTCCTTCAGACACAGCATAAGCGTAGAGCTCGTCAATGGTTTTGGTCTCCTCACCGGTCTCAGACTTCGCTACAGCG
CCGGAGGTGAGCAGAACAAAAACTGCCAGGAGTGAAGCGAAGATCTGCATTGCTACGAATTGTCGAGGCTTTTGTTGAGGCTTCACGGAGTGATTTTGGT
CGACTTGACACGGGGAAAGGGAATTGGACAATG