Description :
From Genome Similarity Track
Location :
Scaffold_3419:308- 1314
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_3419-fgenesh-gene-0.0Replication protein A 32 kDa subunit

Sequence
1006 bases(100 bases per row)
TCTACGCAGTTCGCTTGAAGTGGTTCTCATCGATCGTTGAGTACACGTGGCCCTCGCTCGTGAGGTAGTTGAGCGCGCCGCGCAGCTGGTCCTCGGTCAT
CTGGCCGCGCAGGTCTGTGAAGATCTGGTCGATCTTGAGCCCGCGATCGCTTGTGCACGTGCCCAGCACGTCCAAGATCGCCTTCTGCTCGGGCGAGAAG
TTCGAGTCCATCATGCCGTAGTCCATGCCGCCACCACCCATGCCACTTTGGCCCAAGTACGAGCTGTTGCCCTGGTTCCACGCCTGCTGGCCCACCGGCA
CGTTGAATCCGGTGTTCTCGCCCTTCACAGGTGTGTTGAAGCTGTTGCCCGCGGCGGCGGCGCCACCACCGGCACCCTGCAGAGGACCCTTGGTGTTGTA
GCAGTGCACGTAAATCGCATCCAAGAAGTGGTGCGTGATCTCGTTAAAATCCTCAATAGGCGTCACGGTGAACGCCGACAGCGACACTCTCTCCTGGAAA
ATGCGCAGGTTGCCGACCACGCGAGCATAGATGCCATCACTATTGCACACACATACACACATTACAATTAGCACGCTATGAGCATAAAGGCAATGTATCA
TCATAGAAGCAAACCAATAGACGCACCGCAGCTTGGAAACCTCGTTCTCTGCGTAGTCGGCGTCGTCCGCGTGGAGGAACATGCGGCCCTCGATGACGCC
CGTGCCGTCGTCCAGCTGGAAGTTCACATTCGTCGAGTGCGGCGTGACATTCGAGAGGATGCCCACGAGCTTCACGTTCGTGATCTCCTGGCCGTCGATG
CGGATCACATCGTCGTCCGAGGTCACACGGTTCGCCAGCTGCTTGGCAGTGATCGGCAGCAAGCCCTGCGTTTCTCGCGAGCCGCGACCGCCGCCGCCGC
GCTTGTTGGGCGTGTTCTGGCTGCCGCCCTGGGAGCCTTCCATGAAGCCGCCGCCGCCGCCGCCAAAGTCGTCATTGCCGTACGCCTCGTACCCTCCGTA
GCTCAT