Description :
From Genome Similarity Track
Location :
Scaffold_11:30795- 32531
Sequence
1736 bases(100 bases per row)
ACGCCGATCCCACGAAAGGACATGATTCTTGACTCCATGTCGGGCAGCACCACGTATAGCGCGATTGATCTGATGGACGGATTCCATCAGATCTTGATGC
GCTAAGACGACGTGCCGCTGACCGCCGTCAGCACGCCCAGTGGAATGCTGTGGGAATGGCTAGTCATGCCGCAGGGGCTCAAGAACGCCCCCGCCACCTT
TAACCGCATGGTGTCCCACTTGCTGCGTCCATATCGCGACTTCGCGCCCAGTTACTTTGACGACATCTTCATTCATAGTCATGCCGACGCCGGCATGACT
GACATCGAAGTTCATCTCCAACACCTACGAACGGTGTTCGGAGTGATGCGTGAAAACAAGCTCTACGCCAACCTGAAGAAATGCATCTTCTGCGCCCCCG
AGATTCCAGTCCTCGGGAGCTACGTCAGCAAGGACGGTGTCCGTGCTGACCCCGAGAAAGTAAAAGCCATCTGCGCCTGGCCATCTCCTCAAGACGCGAA
ACAGCTTCGACAGTGGCTCGGCCTCGCGACGTATCTCCATCACTACTCGAAGAACTTCGCGGCGACAGTTCGTCCACTGTCGCAACTACTCAAGACCGAT
GCCACTTGGACATGGCGTCCAGAACATCAAGCTGCCTTTGACGCGGTAAAAACGAGCTTATCCACCGCGCCCGTCCTGATGCTGCCTGACCACTCCAAGC
CATTTCACGTGGTATGCGACGCCAGCGACTTTGCCATTGGTTGCGCCTTGATGCAATTCGACGCAGCAGGGCGCGAACGAGTGGTAAGCTACCAGTCGCG
CCAACTGAAACCAGCGGAACGAAATTACCCCGTACACGACAAAGAGCTACTGGCCATGCGCTATGCGCTGCTCAAGCTCCGAGTTTACCTCTTGGGCGAA
CAGACCTTCGTCGTGTACACCGACCACGCGTCGTTGCGAACCGCAACGAAGAGTCCGCATCTGTCCCAGCGCATGGCGCGCTGGCTCTCCCTTTTCTCCG
AATACAACTTTGTTGTTCACTACAAGCCAGGCAAGACGAACATTCTTGCCGATGCTCTCTCGCGTCGGCCATATTACGCTCAACTTGGCCGCCACGCGAT
TGGGGACGAAGACGACGACGAGTGCGCCGTGTGTTCTGCTGAAGATGTCACTGCGGTGGAAGTCGCAGCGACCAGTTCGTTGCGCGACGCGATCTTGGCC
GCGTACGCGTCGGACGCGGCGTGCTCCGAGCTGATCTCGTTCCTACATAATCCGTCGGAGCCAGCGCGGCGCCGACTGTCCCCGCGGGCCCGATCCCGCG
TGAGCCGCTTCCGCTTACACGAAGGTTTGCTGACTTACAGTGCGGACAACGAAGACTCACCACGCATCGTCGTCCCGCTGGACGACGATCTTCGCGCCCG
ATTGATTCACGAGTTTCACGATTCTCCCAGTGGTGGCCATCTTGGACGCGAAAAGACCTTCGCGTCCCTCTCTCGCGATTACTACTGGCCGCACATGTAT
AAGTGGGTGCGTAAGTGGGTTCGCTCATGCGAAGCGTGCCAGCGCGTGAAGCCTTCCCCGTCGAAGCAAGCACCGCTTCGACCTCTCCAGGTGGCCTCGG
AGCCGTGGTCCTCCGTCAGTATGGATTTCGTTTTCGGCCTTCCCCGCGACGCCCAAGGTCGCACTGGCATACTCGTCTTCGTCGATCGATTCAGCAAGAT
GGTCCATCTTGCTCCAGTCGCCGCTACGGTCACCGC