Description :
From Genome Similarity Track
Location :
contig_14:307945- 309178
Transcript NameFunction/comments
g3525.t1XP_009524502.1 hypothetical protein PHYSODRAFT_557686 [Phytophthora sojae

Sequence
1233 bases(100 bases per row)
CGCAGCGGAGGCAAGCTCATTATCTTCCTGGTTGGACTGCCTGGTCGTGGTAAGACGTACATTGGCCACATTCTGGCGCGTCACTTGACGTGGATGGGCC
ACCAGTCGCGCACGTTTAACACTGGAGAATACCGCCGAAAGCTGGTTGGCTCGAACGTGAACCACGCGTTCTGGGACCCGTTCAACGAGGAATCGTTCCA
GATCCGCACCGAGCTGTCGAAGAAGTGTCTCGAGGACTCGATTGCCGCGTTGGAGAGCAACGACTGCGACTGTGTGATCTTTGATGCCACGAACGTGACG
CGCAAGCGCCGACAGATGCTAGTGAACGAGGTGCACCAGCGATACAAGTGCGAGATGATGTTCATCGAGTCCGTGTGTGATGACCCGAACCTCATCGCAT
CGTCGATCAACGAGATGAAGTTGAACTCTGCAGATTACGCTGGCCAGACGATGGAGGAGGCAGCAGAAGACTACAACAGCCGCATCAACCACTACCAATC
GCTCTACGAACCCCTTGCGGCGGACCTCGAGGGCGCGCCGTTTATTAAGATCATCGATGTTGGCCGCCAGATCTTCTGCAACCAGGTGTACGGCTACTTG
CAGTCGCGGATCATGTTCCTGATGGCGAACCTGAACCTGAAGCCGCGACCGATCTGGCTGAGCCGCCACGGTGAGAGTATGTACAACACACAGAAGCGCA
TTGGTGGCGATGCGCCTCTTAGTCCACTAGGAGTGCAGTACGCCGAGCAGCTAGACCGGTTTACTGACGCGTACTACCCGACACCCGACACAGAGCTCGC
GGTTTGGACCTCGACGATGCTGCGTACGGGGATGACCGTAGAACGCATTGCGGCCCGTGGTCGGTCGATTGTGAAGTGGAAACAGCTAGATGAGATCGAC
GCCGGTATTTGCGACGGCATGACGTACGAGCAGGTGGCCGAGGAGATGCCCGAGGAGTATCTGGCGCGCAAGAACAACAAGCTGCACTACCGCTATCCGC
GTGGCGAGTCGTACCAGGATGTGATCCACCGCCTCGAGCCGGTCATCACGGAGCTCATGCGCATGGACCAGCCCGTGCTCATCGTGGCGCACCAGGCCAT
TCTGCGCGTGCTGTACGCTTACCTCACGAACAAGTCCCCGTACGAGTGCCCCACGCTCAACATCCCGCTGCACGTGGTCATCCAGGTCACGCCCAGAGCC
TACAAGTGCGAGGAAGTGTGGCACCGCCCCATG