Description :
From Genome Similarity Track
Location :
Scaffold_281:3079- 7901
Transcript NameFunction/comments
g14342.t1hypothetical protein
g14343.t1hypothetical protein

Sequence
4822 bases(100 bases per row)
TGCGTGATAGCTTGTTGCTTCCTGGATGCGATCGACTTCACTCGTAGCTCCAGAAGCCGACGAGACAGGAAGCGGCGAGTGGGAACCATGTCATCATTGT
CGGTCTCATTCGCTGCAAAGTACCGCAGAATCAAAGTGGCAGCTTCAGTAAACTTCTGGGCGGTTGGTGCTGTTACCGGAGACGCTTCATCTTGTTCGCT
GCAGTAATCGGAATCTAGGCATGTGGTCGAAGCACACCAGAACTCGACAACAGTGTCGTCGCAGTAGTCATATTTAGTGAGCTGCATTTTAATCAGCCGG
GCAGAGCAAGCTGTCAATTGAAATCTTCGACGAGAGCTTTAGCAAGCGCATGCAGCCTTGAATCTGCTTGACCGATTCCTTCTCTGCAACCTGGACAGCC
CTTGGGTACGGACGTGTGGTCTAGGGAAACTCATATTTTGGGTAGACCACCCATTCTGGCTCAGCTAAGTACGTCGTACCTAATCGAAGTTCGCACCTAA
GCGGCGGACTCGGCGAAGCGGTCGGACTTGGCGAGCACCAAGACTCAGCGACTCAGCGAGCGTATTCCATTTTGGAGTTATTCCAAGTGGGAGAGGATAA
ATCAGGAATCGGAACGAAGGGTCGGCCGAGATCCATAACGACCCGACTCGGCGAAGATCAACTAGGAAGCTAAGCGAAGAGTCGCAGGGAGATCTATAAC
GACTCCATATCACTAGGTATTTGTATAGGATAGATAGGAGACCAAAGGGGGGAGCCGAAGGGACTCCCCGAAGACACAGAGATAACAAAACAGAGCAGAA
TCTTCTAAGTCCAAGAACAGCGTATACTTTCCGGTAAGTCCCTGCGTGGGCTGGATTATGTCTGCCGTCGTTCCCCGAGAGGCATAGCTTGTAGGGGAAT
CGACTGGTAGCGCCAAGAGATCAAGGTCGGCCCGGGGTGGGCACTTCTCGCTACCAGCGAAGACAAACCTCGTCGAATCGACGAGTCGGTGGGTCTGCAC
AACCCAGGACACCGCAATCTTCTAGCTGAGCGTACTCTGCGCTCGGTGACCTGTAAAAGCGCTCGCGCGCCGACGTCCATCCTTTGGTGGAGGTCACAGG
GTTTGAGGAACGGAAGCTGCCCCGCTCAGGCGAGCTTCTGGAGTTTGGATTGATACTCAGCGAGAACAGGGCCTTAACTGGACCCGGCTGGGCCGAACCG
CAAAGGGAACCAACAAGAACCCTGCGCAAGCCCAACAACGCCGACCTGACTCGGCAAATTGTTGTGTTATTGCGTGGAAGCCGCACGAACGACGTTTTTG
TGAATCACAACACCACAGACGGGCAATGTGAGTGGTGTTCGAAGCCAATTTGGAGTGTCTCCAGCAGTTCACTACCGCTGAGCGAGGTGACACGAGACTG
AGTGCAATTTCTCGATTGGAATTAATGGGTGACTAGTGACGGGGATATATGCTGATATTTGATTGGCTACTGAAATTGTTGAGTACTGGTTATGTGCATT
GCGCATGTTGAATGTGGAATTCGGCTGTGTTCCGCGGAGCGGATGCGGTCAGGCTTTAAGATGGCCCCCCCCAGATTTGGAAGGTCAGATTCGGCTCCAA
ACAGCCTGAAACTGGATCTATGTCTGAATCAACCCCGTCTTCAAGCGGGTTAACCCAATGGAGTTGGAAATGTTGGAGACGCTGCCAACCGCTCGATCAT
GTGATTCATATCAATCCCAAGAGAGCGTAGCGTCACCTTGCCTAGCAGGAACGCATCTGTGTCAGCATCCAGCACAATGCATGGCACCTGATACAGGTTC
ACTGGCCCTGCCGCCGTATTGACGCGCAGGTCCAGGAGGGCTTCCTCAGTACAAACAGTCACATGGCCGTCATACATTTCCACCTCCTGCGCCACAACCA
ACGGTGTCAGCCTCACGTCTCTACGTAGCTCCACTAAGTCACCTAAGACACGGCGCGGCATCGCATTGGCATCTGCTCCGCTATCCGGGCAGAAACGAAC
GTCGATGAGGTTGTTCAACCGGACAGAATGACCATCAGCTGCCGCGTAGCCTCCTAGACGCCAGTGCTTCACCTGCCGGCGACTGCTGCGCATCTCCGCC
ATCTTCTGCCAGGCACTTTCTTTTTCTTCATCGCTAGCGGTCGGGTAGTCGTCAAGCCAATGCGGGTCTTTGCACGCCCAACATCCCGTACGAGGTGGTG
GCCGCTGCTGCTCCTTGCTTTGCATGTTCAGCTCTTGGTTTGCTGACCCCCTGTTGGGTCGGCTTCCCCGTATAAGGCGCTGTCTTCGGTGCCACCGGAG
CTGAGTTCTTCGCGTCCCTTCCCTTACCAAACTTATTGCTGAGGGAGTGGTAGTGTTGTTGCAGCCGGGCGTGTTGCAGGATCAGGGTAGAGCTTGACAC
AGTTCATAGTAGCTTCGCGGTGTTTCAGCTTCACCATGCGCTGGATCTCCACGCGCAGCTCCTCGGGTTGCAAACTGTTGGTCAGAGGCTTTCACCGCTG
CTTCATGCGGGGTTTGAAGAAAGGGTCTGACTCGGGGCATGCTCCGAATTGTGCTGCCAGGCCGTTGTCCTCAATGATGCGGTCAAACGCTGCGAAGTAA
TGCAAGATGCGGGCATCACAATCGTCAATGCGCAGGTTCATCTTTAATTTTTCGCGAAAGAAACGATCCAAGTCGGGCACATGTGCATTCTTCAAGTGGT
TGCACCTGTCCGTCACCTCATTCACCAACTCGGCGTCTGTCACGTCAGCCACCGGCTTGCACAGGACGTAGCGAGCTATAATGACCAGAACATCGACGTC
GAAGCAGGACTTCGCACTGGCACAGATGCGCTCTGGAACCTCACCAGTGACCGCACAGCGCTCCGCGATCTTGTCCACGTAGCGTTTTCTTTCACGTGTC
CACGTAACGAGCGAAGCTTGGTCACACGACATAAATGATGAAGATGCGCACTGCAGCGATACATGTACGTTCGGTAGAGCACCCCACCTTACAAACAACA
CATTGCGTAGTAGTACCAAGCGGAGAAATACTTGGTTCATACGAAACATCTTCAGCACTACCACCACAGTTTGATTCACTGAGAAGTCACGAAGGTCACC
CCCCCCCTCACACCTCTCCATCCGGATTTCCACCGGGACAGACATATCGGTATATGGCAAATGCGGCGTTGCTGGCAAATTGAATTGTGTCCTTATCATT
GTCTGTTGCTGCTACAATCCTCTTATGCTCGTCTTCTATATGTAGTGCGGCTCTTGAATGCAAGAAGTCTCACCACCACCAGCGTCGCCACTGAGTGTTG
GTGAGCGCCCGTGATTGCTGCATCAGGTGCGCCTCTGAGTGTCGGTGGCGATTGCTGCATCGTCGCCGAATGTTGATCATGTATAAGCAGAGCGATGCAA
GTGTGTGTGGCTGTAGGATTCCCCACACGGTAGCGGGTATCCAAACTCCGTCTTGGTGGTGATTTAGACGACAGCCCATTACGGCGTAGAGTTCGCCATG
TTTCATTGAAAAATACTCGCTAGCCTGTCGGTCACACGTTTTGTCGGAGTTAGTGGTTGTCGTCCAGGAAATCTGTATTTTACATCTTACCAATAGACGA
AGGCGGGCCGACGCCATCGCCAGCCTTGCGCGGGTTTGTCGTAGTCCTACCGCACTCTCCGGCGTAGAGTCTTGCTGCATGGCTCCGTTGCGTGATTTTC
CGATGTAAGTGAGAGGTCTCCGCAAGAAGACCAAACGTGTAGAGGATTATATGAAGACGTCGGAAGCCAGATTATTCTAGATTCGACGAGCAAGAAGAGG
CGGTGAGTGAACCCAACGAAACATTCTCGCCTCACTTGTCATGCGGGATATCTCAATCCAGCCAACAGCCACATCGTAGTCACATTGTGAACACGGATAA
GGACGGCAAGTACACTCTCATAGACGCAATGGTCATTCTGGGTGAGATCCGTGAATACGTACGAGTAACTTCTAGTATACTTTTGGATAATGGCTTCCAT
ACTGCTTGTTAGTCCACACATTTCATACAAAGCCGATTATCTTATAGTAAAATGGACGACTTTGCATCAGCCTGAGTTGTCTCGCCCATGAAAGCATTGC
GCGCGTCGACCCCACCGTCGGAATGGCTGATGTCAAGTCAACACATGCGTCACCATCAAAAATGTCCACTAGTCGATGCCTTGTTCGCCTCTGATGATCG
AGCAGTCACTGTATCACGTCCTGAGCTCTTTTAGTCGCCGCGTCGATCATGGAGATTGAAGATGATGTGGAGCTGTACACGTTGGTTCACTGCCACACGA
ACACTTCGGATGCCCTGCATTTCACAGCAAGTCACTTTTCCCAAGTCGCCCTTCCTCGCCGCATTGAAACCTCGGCAACTCTGCACACCCGCAACGGCGT
TGACACTCGTCGGGTCTTATACTACGTCGTTGACGTTGGCAGTCTTGGCGACTCTACACACTCGCAACTCGGGCCCGCTGTTACAAACCACCAAGTCCAT
CCGGTGCGTCGGATCTTGAGGGGAAGGCGCCGCTGTCAGATCGAAATCCTTCTCCACACTGACGGCATTGCAAGAGACACAATAGTGCGACGGAGTGCTC
AAGTGACTGTTGAAGGTATTGCGCAGCATGCTCTCCCGCTGCCTGCGCTGTCTCCGGCGCCAGTCCCCACCGCACCATTGCCGCATCATGCAGGGCCAAC
TGCGCGTGGCGGTCGTCGGCTCGCAGACGTGCCATGCAGACTCGCCGCAGGCCTACACCGTCTACCAGACGTCCGTGAACCTGCGCGGCCTGTGCTACCA
CCGCCTCATCCGCTACCGACAC