Description :
From Genome Similarity Track
Location :
Scaffold_692:3079- 6870
Sequence
3791 bases(100 bases per row)
GAAAAGTAGAGGAGAATCCACTCCTGTGGATCAGAGAGGTGGAAATGATTATGAACTCCGCTACGCTCCGGTCAGAGCATCAGCGAGTTAGGGTGGCTAT
CTCGAAACTAGCTGGTCGAGTCAGAGAATGGGTTCTCACATGTAGCACGTCGATAGACGAGGCGCTCCCGCATGGGATTTGCTAAAACAGCAAATATCCC
GGGTGTTTGCTCCGCCTAATCAGGCATACCGAGTGCGTTCTCGTTTCTTATCTGGCTGTCAGGGCAAGAAAGAATTATCGGGATATGTACAAGAACTGAG
AACTCTAATCGCTGCCATGCAGCTTGATCCCTTACCAGAAATGGTTTTGGTTACCATCTCCATAGAGGGCCTTCGCACGGCGTGGCTCGAAAGAAAGTAT
TCCGGGTGCACCCCACCTCCTTTAAGGAGTCTGTGGATATCGCGTTGAACGCTGAGTTCAACGTTAAGGCAGCCTGTTTTGGCACCCATGGGTACAGCCC
AAACGCGGCGAACTCCTTTAGCCCATTCAATAGACCGGAGCATATGGACCTCAGTCTCGACGAGACGGAAGAAGAAGCAGAGCTTCAAGCTGTAGAACAG
CATCGAAACACTCGACGATGTTTCACGTGCGGAAGCACAAAGCATCTACGACCTAATTGCCCTTTACGCAGGGCACGCCAGGCTACTTCAGGCCAGACTC
CCGCCGCTAACCAGAAGTCTGGTACGGTGCAAAAACGTAGAATCCCAGTAGGCGGGGGGCGCCCTGCTGGGGAAGAACTAGGTTCTGTTGAGCCTCTAGA
AGGTAGTGGCGAGCAGAGTTTAGCCCCAAGGAGCACCGTGCACTCTAACAAGGGACGTGAATACAAGCCAGGCTTGTTGGTCGCAAAGGCGACTGTTAAG
GGCTTTGACAAACCCTGGTCGATTTTGATCGACTCCGGAGCATCTGGTAATTATGTCAGACGCTGTTCCCTTGAAGGAAATCCATGTTATGTTGAGGCGC
TAAAAGTGCACAAGGGTGATACGATCACTGTTCGCTTGGCGACAGGAACCTCTAGTCACTGCATTCAAAGTTCCTGTGAACTTGGGTGTGAAATTTTTCG
ATTTTGATAGTATCGAACGCTGTTTGGTCTTTGATTTGGACTCGAGATCTGATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATAACCCATGGATAGA
CTGGAGATCGAAAACATTAGGCGCCACGCGCACAGCCCCTAGCGGAGCTTTGGAGAGTCACGAACCCACCTCTGCTAGGAATCAAAAGCGTTATTGGCGC
GAGCCACTAGCTGACAATGTCAGTGTACTGGACATCGGAATGTCAGATTAGTTGATTCTGACGATGTCAATGACATGAGTATAGTACAAAGCTCGATATG
TGAGAGTGAAGCGGCACTTACTCCGCTAAGTGATAGTTGTATTGAGAGCAACGTACTGAATGATTAAAGCATTGTTGACCAAGCGTCAAATCATCGAGGG
TTGAACCCATCAAATGAGCGTGGAGTGGCACGTACGTACCCACTGAGTGACGTTGGCTGTGATAGCGACGCGCTGAATGTCAATATTGACGTTGTTGGTA
AAATACCAAGGCATCCCGAGTCCGGCTCAGCGGATCTACGTGAAGTGGCACGTAATCCACGTGATGACGACGTCATGTCCAATGACTCGTCATCGGATGT
CAATAGTGACGTCAGCTCTGGTTTAGAGATAATTAAGGTTGATGATGGTGTCGATCAGAGAGGTACGAATCACACATCGTGTGCTGTGTCACAAAGTGGG
GATGATTATCAGCTGTATACACTCGTCAACGGAGTGACTAGTGCTTGTGATGGTAAAATTAGCTTCGGGGTATCCCTCGTTAAGTTCTCTTTTCGAACTC
GAAGAGTTGTCGGTCTATGAGTTTGATCACTCACTAGAGAATGGAGACCTTTCAGAGGTGGTAGTCATTCAACCCGACATCATAGAGTTGAACTCTTCTT
CACGTTTGGATGAAGCCGTTCTGGAGGACACAAAAGCAGCACTCATTGCGCGAAGTGGGTCATCAATATTGAAAGACCCTCGTGCTCCCTTTTATTTCTT
AGTCAGGGAATTTCAAGGTGTGGTGTGCCACGATCCACCCTCTGTTCTACCTCCAGATAGATGTGTCCGTCATGAAATTGACTTAGTTCCTGGGACGAAA
TACTGTGTCACGACAGCGGCCCTTGCCCAAGGAGCAAGGTGATGTCATTGATGACTTCTTCCGTGCTAAGCACGAGGCGGGAATGGTACGTGAGAGTAAA
TCTCCACATTCCACACCCACATTTTGTGTCGTAAAGCCGAACGGCGAGTGGGGTATTGTGCATGCCTATAACAAGCTTTATGCCGCTACGATTCCGGCAC
AGACACCCATTCCTCGAAAAGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGCGCACTCGACTTGGTCGATTGATATTATAAATTGCTTAT
GCAAGCGAGTGATATTCTGCTTACATCAGTGAGTCTCCGAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAAGGTCTGTCTAAATCTTCGGCAACAT
TTAATCGTCTGGTGGCGCAACTTTTCCGCCCACATCGGGATTACGCAAGGACGTACTTTGATGACATTTTTGTCCATAGTCGTGGCGAAAAAGGTCGGTC
TGACGTTGAAAATCACATCAGTCATTTTCGAGCTGTGCTCGAGTGCATACGCACTAACAAACTGTACGCCAACGCGTCTAAATACATTTTGGGTGCAGAG
GAGATTCCTTTTGTAGGATGTTTCATTGGTAAGCACGGCCTTAGAGCGGATCCCGCTAAGGTCAAGGCTATAGTGGACTGGCCGATTCCTAAGAATAAAA
GAAGACTTGCGTTAGTGGCTTGGCCTTGCCAAAACTTAAACAAGTACAGTGAAATTTACGTTGATATGGCTCGGCCATTAACTGGTCTCCTTAAGAAGGA
CACAGAATGGCGCTGGGGAAAGAACCATGATGACGCATTTCGGGCAATAATTGAGAGTTTCGCCATGTTTCCATTTTGGCGTTTCCAAATACATGGTACC
CTTTTGTTGTTGTCTGCAATGCATTCAATTTTGCTATAGGCAGCGCCCTGTTACAAACAGATGATGCAGTCTGCGAACGAGTTATCGCATTTGAATCTCG
TCAGCTGAAAGCTGCTAAAAAGAATTATCCAGTTAATGACAAAACGCTACTTGCTATGAAGTACACACTCGTCAAATTTAGAGTCCATCTTCTTGGCTCC
AAACAATTCGTCGTCTATAGGGATCATGCGTCATTACGCACGGCGACACAGCCGCCTCACCTCTCTCAGAGAATGGCTCGGTGGCTTTCATTCTTTGCGG
TTATAACTTCGAGGAGAAGTATAAGCCAGGCAAATAAATGTGTTGGCAGATGCCCTCTCTCGTAGACCTGATTATGAGCTTGCTCATTTCACGACTTTGT
CGTCTCCTATTGAGGACTTAATTCGTGTGGCATATCCACGGGATTCTCAATGTGTGGCATTTTTTCATGCCCTTGGTAGTGAGGAATACAAGGACTTGGA
CAGTAAGTTATCGGCACGCTTGCGGGCCAGCCTACATCGATATTCCATCAATACTGGTCTCTTGTGCTATCGCACAGATGTAGCGGATACCGCCCGCATT
GTTGTGCCTCACAATGAGTATTTAAAGTATCGAATCCTCTTCAAGGCCCACGATACTGGCATCAGTGAGCATTTGGACCGGGAAAAGACTT