Description :
From Genome Similarity Track
Location :
Scaffold_1935:3079- 4089
Transcript NameFunction/comments
Phyta_totarag13892hypothetical protein
Phyta_totarag13893hypothetical protein PHYSODRAFT_526122

Sequence
1010 bases(100 bases per row)
GCTCTTCGGCGACGAAGCGTTCGCGAAAGAATtcgtgcgctgctggataGAGCACACAGAGCCCTGTGTTGCTGGCGTCCATAAACAAGCGCACGACCGG
CTGCAGCGTACCCGCGAGGATACTCGTCGAGACCTTGTTCATGGCGCCGTGACGTAGGAGCGATTCGACCCATAATAAATCATTTTGGGCGACAGCAGGA
ATGCGTACGGAGCCAAAACGTGGTGCCGCAAGCCACAGCGAGTGAAGCCACTGGATGAACGCCCGCGTCGCTCAGTAGCAAATACCGATGTGGCGGAGGG
ATCccaacagcttctccagtTGAAGTCAGATTGCTCGCTCCGCTGCCAGGACCTCGAGGAGCCGACTCAGCGACTTGTCGACTTTATCCTGGGGCATTGA
CACGGTTCTCTCCTGGGTGTCCCATAGCAGGCCGAGTGCGGTGAGTTGGGTGGACCACGCCGATAATTTTGTTTCATTTATCGCGTCGGGGCTCAACGTT
GCCAGCATGCTCAGGCGGAGAGCCGTTTCGGCAAATTGAAGGCGATCCTCCCTGTCGACTTCCACAAGGACATGATCATCGACCCAGACATACGAGAAGA
ACGGCTCGGTGTCTGGATCACATTGGTCGAGCGAGTGAGGGCTTTCGCGAGCTACTAAAATGGAGATTGCGCCTCCAAATATCCCGTAATACGCGGGGAT
CCTGTCCAACCAAAAGGCAGCGCCAGATCAACCACCACCATATCGGCTTGGCAGGAACCCGAGAAGTGGGCGGACAGGGAGGAAGCCACAGCTATTCGAC
GAAACGCGCTCTTGACATCCCCTTTGAGCATGTGAACGATCCGTCGTGGATGCGCCGACGCCACTTCCTCGATGTGCTGTGGAATACGCCGAATACTCTC
GAACTCGAGATCTGGAATTTCGTCTTGAGAGGAGCGAGCGTTGATTGAATCTGCACCTGGGTGTGCTAGATCGTGGATCAGCCGGGCAGCTGTGGTCGGA
TCAATATCCT