Description :
From Genome Similarity Track
Location :
Scaffold_230:30788- 32940
Sequence
2152 bases(100 bases per row)
GATGTAGGTATTCTAGCGGGGAATCATCCGATCTGCGATAGCATGGTATTTATTGTCGTGCCACCGACACTCTCAATCCACAGTACTGGGTGTGGAAACT
GCGCAGCAAATCTGGCCACTTGTTCCTGGTGAATCTGTCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGTAGATCCGCGAAGGTCAGGCACTTC
TCAGCATCCGACGCTTGATCTCTTATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTTGCCCGGTCCTCGTCTTGATCCTTGCCCGTGAGCTCCTTCA
TATCCGATATGGCTGAGATCCGAACCCTCTGGATCATGGACAATCCACCCGCCCCGGCTGCGGCTGTTGCTACCACCGCTGACGAAGGGGATGGGCCATC
CAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGCC
ATGGGCGCTCTCATACCCTGTTCGGCCAAAAACCGACTCATGGCAGCTTCGAAGTGTCGCTGTAGGGTGCTCGAGGAAGTGTCGGAAGAAACTGTGGCCG
TCTGGTCCACTGGAGAGTCAGGATCCGTGCGGCGATTACCTTGAGCCCGATCTGACGATAGTCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCT
GGATTGTGTCAGATCACGAGTAGGGCCTACTGGATCCCGAGCCTTCACGCTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGAT
GCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAACGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCC
TCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTC
TAGCTCCAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTT
TTCGTTGGTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGACGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAACGCTTGGT
GGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTT
ACTCGTTCTCGTCTTCTTTCTCGTTTCTTCGAATAGCGGGCTTGGGTTTAGGTTCGGAGTGGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCC
TTCACTTTTCTTTGTTTTGTTAGCGGATCTTGACTCGCGTCAAGGTCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTATCTCTTCTAGAT
CCGGATCCACCTCTCTTCCGTCGACCGAGTTCCTCCCAAAACACCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGA
CGACGCCTCTTGCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAATGATCCGGGCACGCGCACCATTGTG
GCGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAGCTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTC
TGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAATAGTTCAAGTGGTGAAGCCTGAGCGTCTTGGCG
AGACGTGGGGATGGGGTGGAGCAGCAGAGAAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGC
CTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTTGCCTTTGCTTTTCCTTTGCGTCGTACTGGCCGCCTCCTGTGACGGGATCTTGA
GAGTTGAGACCTTTTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCT