Description :
From Genome Similarity Track
Location :
Scaffold_11:30787- 33627
Sequence
2840 bases(100 bases per row)
CCGGCACAACGCCGATCCCACGAAAGGACATGATTCTTGACTCCATGTCGGGCAGCACCACGTATAGCGCGATTGATCTGATGGACGGATTCCATCAGAT
CTTGATGCGCTAAGACGACGTGCCGCTGACCGCCGTCAGCACGCCCAGTGGAATGCTGTGGGAATGGCTAGTCATGCCGCAGGGGCTCAAGAACGCCCCC
GCCACCTTTAACCGCATGGTGTCCCACTTGCTGCGTCCATATCGCGACTTCGCGCCCAGTTACTTTGACGACATCTTCATTCATAGTCATGCCGACGCCG
GCATGACTGACATCGAAGTTCATCTCCAACACCTACGAACGGTGTTCGGAGTGATGCGTGAAAACAAGCTCTACGCCAACCTGAAGAAATGCATCTTCTG
CGCCCCCGAGATTCCAGTCCTCGGGAGCTACGTCAGCAAGGACGGTGTCCGTGCTGACCCCGAGAAAGTAAAAGCCATCTGCGCCTGGCCATCTCCTCAA
GACGCGAAACAGCTTCGACAGTGGCTCGGCCTCGCGACGTATCTCCATCACTACTCGAAGAACTTCGCGGCGACAGTTCGTCCACTGTCGCAACTACTCA
AGACCGATGCCACTTGGACATGGCGTCCAGAACATCAAGCTGCCTTTGACGCGGTAAAAACGAGCTTATCCACCGCGCCCGTCCTGATGCTGCCTGACCA
CTCCAAGCCATTTCACGTGGTATGCGACGCCAGCGACTTTGCCATTGGTTGCGCCTTGATGCAATTCGACGCAGCAGGGCGCGAACGAGTGGTAAGCTAC
CAGTCGCGCCAACTGAAACCAGCGGAACGAAATTACCCCGTACACGACAAAGAGCTACTGGCCATGCGCTATGCGCTGCTCAAGCTCCGAGTTTACCTCT
TGGGCGAACAGACCTTCGTCGTGTACACCGACCACGCGTCGTTGCGAACCGCAACGAAGAGTCCGCATCTGTCCCAGCGCATGGCGCGCTGGCTCTCCCT
TTTCTCCGAATACAACTTTGTTGTTCACTACAAGCCAGGCAAGACGAACATTCTTGCCGATGCTCTCTCGCGTCGGCCATATTACGCTCAACTTGGCCGC
CACGCGATTGGGGACGAAGACGACGACGAGTGCGCCGTGTGTTCTGCTGAAGATGTCACTGCGGTGGAAGTCGCAGCGACCAGTTCGTTGCGCGACGCGA
TCTTGGCCGCGTACGCGTCGGACGCGGCGTGCTCCGAGCTGATCTCGTTCCTACATAATCCGTCGGAGCCAGCGCGGCGCCGACTGTCCCCGCGGGCCCG
ATCCCGCGTGAGCCGCTTCCGCTTACACGAAGGTTTGCTGACTTACAGTGCGGACAACGAAGACTCACCACGCATCGTCGTCCCGCTGGACGACGATCTT
CGCGCCCGATTGATTCACGAGTTTCACGATTCTCCCAGTGGTGGCCATCTTGGACGCGAAAAGACCTTCGCGTCCCTCTCTCGCGATTACTACTGGCCGC
ACATGTATAAGTGGGTGCGTAAGTGGGTTCGCTCATGCGAAGCGTGCCAGCGCGTGAAGCCTTCCCCGTCGAAGCAAGCACCGCTTCGACCTCTCCAGGT
GGCCTCGGAGCCGTGGTCCTCCGTCAGTATGGATTTCGTTTTCGGCCTTCCCCGCGACGCCCAAGGTCGCACTGGCATACTCGTCTTCGTCGATCGATTC
AGCAAGATGGTCCATCTTGCTCCAGTCGCCGCTACGGTCACCGCCAAGCATTCTGCGGCGACGTTTCTGGATCTTGTTTATCGCCATCACGGCTTGCCAA
CATCGATCGTTTCCGATCGCGATCCCCGCTTCACCTCCGCTTTCTGGTCAGATATCTTCCGGCTTGTCGGGACGCGGTTGAAGATGTCCACCGCGTCGCA
TCCGGAAACGGACGGCCAGACGGAGCGTGCAAACAGGGTCGTTGAGGACGTGTTGCGGAGCTTCGCCACGTCATTCACGTCCTGGAGCTCGTTCCTTCCC
ATGGTCGAGTTGGCGATCAACAATGCGGTTCACGCATCGACGGGGCTCACTTTATTCTACGTGAAATACGGACGCCATCCCCGCGTCCCTGCCCTCCTTG
GCATGGATCGTCGGTCCCCAGTCGAATCGGACGCGGTCACGCCCGCGCCAGTACCCCCACCGAACGAGACGGACGCCTCCGATGTTGCCCCTCAGCGATT
CCCGCTGACGATAGTCGTGAGCAAGCTCACGACGTCACCTCCGCGATTTTGAATGCTGTCATCACCCGGCGTGGAGCCGCATCTGCCGCGCCAAGTGTGC
GCACGCGTGGTGCCACGGAGGCAACACCATCTTCACTGACCACCTGGACGTCCAGGACGCTGATTAACCCGCGTCAGCATCGCCGCGCATTTGAGTACCA
TGCAGCGACAGGCTCGGCCGCTTCACCCGAGCCTCCGCCCGCAAACTTCAATCCGAGCCCTGAATCGCTACCGCGTGTTCCGCGGCTGCTCTTGCATTCG
TCCAACGACGCGAGTCGGTAATTCGCTATGTGCGCGACGCCATCGCTATGGCGGTGGATCGCCAGAAGGAGAACGCAGACAGGCGTGGTCGCAAGAATCT
CGCGACGTTTGCAGTAGGCGATCGTGTTTTGCTATCCACCGACGGCATTACACCCACTTCTGTGACGAACTTGGGCGCCAACAAGCTGGCGCCGCGATAT
ATCGGACCGTTCAAGATATTGAAGGTATTAGGTGACGCGTATACACTTCGACTACCTACAGCACTACGCCTCCACCCTACCTTCTACGTTGGTCGCCTCC
GCCGCTATCACCCTTCGTCTATCCCCAGCGACGCGGATGG