Description :
From Genome Similarity Track
Location :
scaffold_55:30787- 33420
Transcript NameFunction/comments
Plaha_PHALS_10491dead deah box rna

Sequence
2633 bases(100 bases per row)
TATAATGTGATTCACTACCGTCTTTTAATGATGACTTTGCTTCTAGTAGGAGCACCATGGCTCTTACCCTTGATATTGCCTTTTCCACGCTTCGATTTGA
CACCTGAAGTGACTTTAATGCCACGCGAGCGAGCTTTACGCTTTTCTTCCTTCCGTATCTTGCCTTCACTTAATAATTCGTCTTTAGCATGCTTATTTAC
ACTACTTCGACTGGCCATTGCAGCACTTCGTGGCTTCCTGCCATTACGGTAATCGAGTTTCTGTGTCTTATCGCTTTCATCCTGCTCCACACCACCACCT
GCcacacgcttgtgctgcTTTTGCTGCCACTTGCGATACACTTCACCCACTTGCTGTTTCTTTCGTACGCTCACTCCACTTTCATTGCGTCGTTTTAAAG
TACCATGACTCGTAAGCTCTCCAGCAGTCGTCTTAACAAACTTTTTCTTACGAACATCCCAGTGAAGAATCCGTCGCTTTTTATTCATTTCAATCGCTTC
ATCGGGGTTGACATCCAAAATGGCCTCTTCAAGACGTGCTTCCGCAAATGCATTCACTTTTCCACCATCTGCATTCGTAGCTAAGAAACCCTCAGTTGTA
TAATCTTTATCCTTCATGTAGTTGATATAATTATCGTCATCTTTAAACGATGAGCGTCCACTCACGTcagcatcttgctcagacgcAGTGTTGCTTGAGC
TCTGCTCTTTCGTAGCTGCAAGCTGCTTCATCACATCCTCTTCCTTCTCACCAGCTGCCACACGCTTTTTTAGTTGTTTGCGCTCATGCTTAGATAAGAA
ATacgttttcttcttctgtgcTTTCACAGCTTCTTCTGAATCTCCTTCATTGTTCAATTCAGACTTTTTCACTTTTTCCGAATTATAACTCTCCTTCTCT
TCAGCTTCAGCATTCTGTGCACTCGACTCTTCCTTTGCTTTCATCTTGTCATCTAACTTTGTCGTCTCCGTAGCAATGATCTTACCATGCAGCTTGCGTT
TCTTAACCATCATTTGAACACCCGGTGACGAGCGTTTGGCTGACGAGTGAGAACCCACAGCAATCTCAAAAATCGTTTGCGGTGGACGAAATGTCTGTAG
TGAGTCAATGTAAGCAGCTTTGTCGGCCTTACTCTTGTCAAGCACATACTCTTGTTGAAATAAAGGATGCACCTTCTTCACTGCAAGCTCTTTACCACGA
CGAATCGAGTTTTTAGACGGATCAGCGCGTGTTCGCGCGTACGCTTTGTACGCATTTTCACATACTTTTACCAGTGGTGCTACTTGTGGGTGGCTACGAA
GAGTCTCTTGGATAGCTTCATTCTCTTGATCAATCAACTCGTTTGGAAATGCACCATAATGAACGTCTTCCACACGCATTGTGCTCAGGGTGTAAGGCTT
AAACCCGGAACATTCTTCTGGTGAAGAGTCTTCAAGACGACGTCCGATGTACAAATGCAAATCAACCATAAATGGCGTCTCATCTGGATCAACAAAGCTA
AAAGCCGTACCAGTGCGACCAGCACGAGCTGCACGACCGACACGATGCACAAATAGCTTCGCAGTTGGTGGAAACGAGTAGTTCAGTACATTGTTCAGCA
ATGGAATATCAATACCACGTGCAGCCACATCCGTCACAATCAACAAATTTGTCTTTTTTGCCCGAAATTTACCCAAATTAATTTTCCGTGAAGCTTGATC
CATGTCGCCATACGCACAAGACGCTTCAATATGATTTGCAGCAAGTAAAGCATGCAGAAATTCAACATGATGACGTGTAGCTGCAAATACAATCGTTTGA
TCTCCTTTCGGTAAAAATTCGCGAACCATATACAAAAACAACGCCGGTTTGTCTAATGATCGCACTGTAAAGAACGCCATTTTTAAGTTTTCCGAAATTT
TATTCTCCACATCAAGACGAATGAGTTCTGGCTCACTCAAACCAGCACGTGCGAATTGTACCAGCGCTTTTGGAAGCGTCGCAGAGAACAGCAATGTCTG
TCGACTGGTTGgcatattttttaaaatttcttgtAATTGTTCAGCAAAGCCCATTTCAAAGATTCGATCAGCTTCGTCAAAAACGACATATTCAACAGCT
TTAAGATTAAAATCGGGAATCTCTTGTAAAAGATGCATGAGACGACCAGGTGTAGCAATCAATATATCCGGATTGGCGGCAATGGCTTCAAATTGTTGGT
CCATACCTTCTCCACCTACAATTAATGCCATTTTCAGCGTTGTAAACTTGGAAAGTAATTTAGCAAAGCGCAAGGTCTGCACAGCTAATTCGCGCGTCGG
TGATAGAACGACAGCACGCACTCCAATCTTTGTCGAATGTTCCTTTAGTTTTTCAACCATTGGAATTAAAAAAGCAGCAGTTTTACCAGATCCTGTACGA
GCCATGGCCACACAATCTTTTCCCGACAAGACAATTGGCAACGATTTACGTTGAATGGGTGTCGGAACCTTATACCCCATGGCCATAACACCACGAAACA
CTAATGGACTTAATCCAAGATGTTGAAAACCGCCTACACCCGCACCTTTTCCATTACTCTTGCCATGTATGGTACCTACATCAGCATTTCCTCCTTTCTT
CTTGCCTTTCTTGAGCAGATCATCACCAGCCAT