Description :
From Genome Similarity Track
Location :
Scaffold_44:307835- 310046
Transcript NameFunction/comments
Aphas_H257_12555CULlin protein 1

Sequence
2211 bases(100 bases per row)
CAAACCGCTGATTGAGCTCGAAGATGGCTGGCAGAAGATCAAGCTGAAGGCCGTGGACGTGCTGCTTGAGATCCTGAACAAAGGATTCGACAAGGTGACG
ACATGTCCCTTCCCTCCATCGCAGTACATGCCGATTTACACGGTGTGCTACGATATGTGCACCCAACGCACGCCGTACAACTGGTCGGCGCAACTGTACA
CCCGCCACGGCGAAACGTTTGAGGTGTACTTGCAACAGAACGTGCTTCCAGCGCTACAGAACCAGCATGACGAGTTCTTGTTGAACGAACTGCACCATCG
ATGGCAAAACCACAAGCTCATGAACAAGTGGATGGCCAAGTTCTTCATGTACTTGGACCGGTACTACGTCAAGCACAACTCGTTGCCGACGTTGGTGAAT
TCAGGCTTGAACGCGTTCAAACTCGTGGCGTTCTCAGCGATCAAGAAGGACGTGGTGGACGCGATGTTGGAGCTGATAGAAAAGGAGCGCGAAGGGGAAA
TCGTCGACACGACGTTGTTGCGCAACTGCATCGAAGTGTTTGAGACGATGGGGATGGGGTCGCTGGACGTGTACACGTCGGACTTTGAGGAGCCGTTCAT
CAAGCGCAGCACGGCGTACTACGCGACCAAGTCGCAGGCGTGGCTTGAGGTGGACTCGACGCCCGCGTACATGAGCAAGACCGAGGAGAGTCTCAAGAAC
GAGTCGAGCCGCGTGGCGCGGTACATGCATTCGACCACGGAGGCCAAGTTGCTTCGCGCGCTCGAGATTGAGTTGCTGGAGAAGCACCAGAAGCAACTGC
TCGAGCGCGAGAACTCGGGGTGCATTGCGTTGCTCCAAAACGACAAGTCCGAGGACCTGTCCCGCATGTATCGTCTCTTCTCGCGGGTGCCCGAAGGGCT
GGCTCCGATCGCGGTGCTCGTGCGCCGTCACATCGAGGCGGTAGGCAACCAGATCGTGGACCTGCGCACCCAGGCCATCGTAAGCGACAACATCAAGGAC
CCGTCCGCCGACCCCGCGTTCATCAAGGAGATCCTAGCCCTCCACGACAAGTACGTGAAGGTGGTGCAGGACCAGTTTGGCGGCAACTCGCTGTTCCAGA
AGGCGCTCAAGGAAGCTTTCGTCGAGTTTGTCAATAAGGACGTGGGCAAAGACTGCTCGGCCAAGCTCATGAGCACATTTTGCGACCGCATTCTGAAAAG
CGGCGGCGAAAAGCTGAGCGACGTCCAAGTGGAGGAGTACCTGGAGAAGGTCGTGCACGTGTTCTCGTACCTGACGGACAAGGACTTGTTTGCCGAGATT
TACCGCAACCAACTGGCGAAACGACTGCTCAACCAGCGGTCGAGCTCGGACGATGCTGAGATTTGCATGATTTCCAAGCTCAAGCTGCGCTGCGGCGCCC
AGTTTACGGGCAAGATGGAGGGCATGCTGAACGACTTGGCCATCGGCGGCGACCACCAGGCCGAGTTTGACGTGTTCCAGAAGAGCCACAACCACGGTGC
GATCGAGTTTGGCGTCCAAGTTCTCACCACAGGCCACTGGCCGTCGTACCAGCCTCTGCAAGTCCACCTCCCCCCTCGCATGGTCAAGTGCATGTCGCTG
TTCAAGACGTACTACGACTCGAAGACGAGCCACCGCCGCCTCCAGTGGGTCCACTCGCTCGGGAACGCCACTGTCCGCGCCACGTACGCCAATAAAAAGT
GGTACGACCTCCAAGTAACCACGTTGCAGGCCGTGGCGCTGGAGCTGTTCAACACGGACGCATCGCTCACATTTGACCAGCTGCAGGAAAGCCTGAATGT
GTCACCAGACGTAGTCAAGCGCATTCTGCACTCGCTCTCGTGCGGCAAGTTCAAAGTGGTGAAAAAGACCCCCGAGAACAAGAGCATCGCGACAACAGAC
ACGTTCCAGGCCAACGCCGCGTTTGCGTCGCCCGTGCGCAAGCTGCGCATCCCGATGGCGTCTCTGGAAGAGAGCCACAACCCCAAACACGTAGAGGAAG
ACCGGAGCATTGCGATTGAAGCCGCGATCGTACGCATCATGAAGGCACGCAAGACACTGAACCACCAGCAGTTGATCTCGGAAGTGCTCAGCCAACTGTC
GTTCTTCACCCCCAACCCCAAGCTCATCAAGCGCCGCATTGAAGCGCTCATCGACCGAGAGTACTTGGAGCGCGACCCTGATTCCACGACCACGTACCGA
TACTTGGCGTA