Description :
From Genome Similarity Track
Location :
scaffold_952:3078- 9292
Transcript NameFunction/comments
g10685.t1hypothetical protein
g10686.t1hypothetical protein

Sequence
6214 bases(100 bases per row)
ACGACAATGCGGTCCGCATTGTCGTCCCGAATGATCATGATCTACGATTGAGGATCATGTTTGAGTATCACGATGCCCTTACGGCAGAAGACATACACTC
TTCTCACGCGTGACTTCTACTGGCACCACCAGTACAAGTGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGCGTGAAGCCTGCGCCGTTCTC
GCAGGCTCCTCTTCAGTCACTTCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCCTTGGACTTTGTCTTCGGTCTTCCGCCTGACAGCAAGCCGAGGACG
GGCATCGTTGTCTTTGTGGACCGATTCAGCAAGATGGTCCATCTTGCTGCCGTCCCGACTACTGTTACAGCCGCGCAGACTGCGCGACTGTTTGTTGACA
TGGTGTTCAACCACCATGGCATGTCGCTCGATATTGTGTCGGACCGTGATCCACGCTTCACAGCGCGGTTCTGGCAAGAAGTGTTTACACTTCTTGGTTC
ACAGTTGTCAATGTCGACTGCGGGTCATCCGCAGACGGACGGACAGACCGAACGCGTCAACCGTGTACTGGGTGACGCGCTGAAGAGCTGCGCTCACTCG
TTCCCGCATTGGAGCGAGTGCTTGCCGATGGCAGAGTTTGCCATCAACAACTCGGTGCATGCCTCGACTGGGCAAACACCGTTCTACGTGGACGCCATGA
GGCATCCACGTTTGCCGAGCATGTTCGGCGGGGTAGCTTCCTCCTTAAGTGGGGGAGGATCTACGGTTTCGTCTTAACAACCGCAGAATACAGCTGATAG
CACACTATCAGCTGCGGTGACGCGTGCAGCGTCTCGTTCGAGTAGGAACGGACGTGCGATGTCTGTGCCGGGCTCATACATAGGGAGTGATGGCGCGCAG
GCAGGGACTGCTGCGGACGAAGACGACGAGCTGAAAGGATTCAGCTCGAACGCGCTAGACTTCGTCCAGCGAAGACAAGCCGTGATACGGTTTGTGCAAG
ACGCTATCGCAGCTTCTGTCGATCGACAGAAGCTGAACGCTGGTAATGTTGGCAGGGGCAACATGAATGAATTCAAAAAGGGTTCATTGGTTTTGTTAGC
TACTCAAAACCTGCCTAAACATGCAGTGTCTGACTTTGGAGCAAGCTTGCTCCAAGATTCATTGGATCGTTCACAATACTGGAACGGCACGGCAACGCGT
ACCGGCTGGACATACCGTCCAGCATGAGGCTCCATCCGACGTTCTACGTCGGGTGGTTGAAGCCGTACGTGCAGCACGAGTCATCTAGGGTTGATGACTC
GCCTGGGAGGCCTGGAAGGCCTCCTTGAGCTTGCGGAGACGCTCGGCATACAAGTTCAGCCTCGACCCGAGGCTGGGCGAGAGGTTTGAGGCCGTCTGAG
CCGCCTCAACGGCGTCAGCACGAAGGTTCCTCACCTCTTGACGCAGAGACGCTATCTCAGCGCTCTGGGAGTGCTCAAGAGCAGCAACCCGATGGTGCAG
GGCACGATCGTGATGGTCATAGCGTTGAACATACGCAGGGAGTGTTCCCACCCCCTCCGCCGCCGTTGCGTGACGCGAGAGGAGCGATCCGCTGGATAGT
TGAGCGGATCGTGGATCATACGACGACGACCCATCAAAGTCGTCGTTTTCGAATTCGTTGGAGAGGATTTCCTCCCCATCGAGATTCATGGGAACCACGG
AACGCCCTAATGGAGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCCCGCCATAACTTGCAGGGTTAAGCCCTGTACGAGGAGTGCTGCGGTCAGCCAC
AGCACTCGGAGCTTCGCGTGGCTCAATACGAGTACGGATCTCCTTGATGTGATCGGGTACATGCACCGACGTGTACCCCGTAAGATCACTTTCAGAGAGG
CGTGCTGCCATCGGCAGGCAGCACGGGCAGCTCGTGCCAAAGGGCACGGCGCAGGGAATTCCCGCTTCCATACATAGACCATGGAGGCGTTCACACCTAC
CGCGAACGGTGTAGGTGTAGTAGCGTTCGCGAGCATTGTCAACACGCTCGCGATAGGCTTTCGGAGCCTTGTTGAAGTTATCAACAAAGGCGTTCCACGA
CTGACAAAGTGCCTGCCACTCTGGCACTTTGCTCTTGCGTGAAGTCTTCTTCGCGCTGAAGTATCGGAGCTCATGGAAGAGTCCGATGTAATAGTCGCGT
CTTTGAGTCGGGGACTCAAAGACCGTGTTCTTGGCGACTTCGTCGTCAATGACCCTGTTGTCGTGATACAACAGGATCGGGCTCGGTGGGCAACTAGCAC
CGAACCGCTCCTGGATCTCAGCCTCGGAAGGCATCCAGGGTGCGCGCACTGGCGGAGGATCAGTGCGCGGAGAGATGAGCGCCCTCGACATCGGGGACGC
TTCATCGTCGCTACGCGGACGCTTCGAACTGGAAGCGTCCGGAGCCTCTTCACGGGGACGTCGAGATCCCAAGGGTGGGTCATGCGTGTCTTCAGAAGAA
GACACGGGGGCAGGAGCTTTGTCTTCAAGCTCGCCCTCTTCAGGATCTTCCTCATAATCGATGAGATCCTCCTCGTCCCCAAAGAGTTCTCTGGGGTCGA
CAGCGTAGCTGGGCTTCGCTGCATGCTTCTCCTTCTGGAGAGCATAGTATTGACCGAGAAAGAGGTTACCCTCTCTCGTATGACTGGAAGCAGCAGTGCT
AGCAGGCACTGCCGCTGTTGTTCCTGCCGCAGAGGCGGCAGGAGAGGCTTGCGCGTCCGCGGCTGCGGACGAGGACGTTGGCGTTGGCGAGTTCATCTTG
GAATGAACTCGGGTTTCTCTCTGGGACTTGACGGTCTGGTCAAGTTCTGTCGATTGACGTATCGGTCCCGATACATTAACTGTTACAGGTTGGAAAGGAA
CCTCCAGCATTGGTGTGTGGGCACACCAATAGCTACATGGGCGGGCCACCTTGATGGTTGGCTCGCATGCATTTACGCATGTTATTGGTAGAAACGTATG
GATTTCTACCAATCAGTGTGTGACACAAGGGTAGGGGTTCTGCCAACCACAAGTTGGCAGACCCTTTTGAAATAGATAAACAGATTTAGGAGGCTCGATA
ATTGGATTTTGCCATATTCAATAACACTTCTCATTTTACGGTATTTTTGCAGTTTAATTGCTTATATTTGGTTTATTTATACTTACTGAAGTAAGTATAA
TTAAGTTAAGTCTAAACTAATTGCACGCTTCCTCATACACGTAAGCGCACGTGTACGCCACCTAGTGGGTCTAAGTAGACCCATTACAACGTCAATACGA
GCAGTTATTTCCAGAGATTCAATTCTACGGAGGCCTGCCGTTTATCCCTTGGGATTCTTTGAAAGAGAAGGTTTTTCGGAGGCCACGAGGTTTGACACAA
GTTATCGAAAAACATTTCAATGGTGAACTACTGTTTGTTGACGAGGTTGATTCGAGAGCAGTGTTGAACTCAACGAATTTTCATCGTGAATACATGGGAC
GGAACGGGAAGGTGTTCCTACGACTTGAACATGCGTTTAAGTACGAGTGCATGTTAAATTGATTGAAGAGCTTACTGGGGGATTGGTTCCGTGATGTTTA
TACCCCGGAATTGTCGACAAGTGATTCAAACTGGCAGTACGCGGTTCATCGAGGCCCTTTCGTTGCTGGCGTGTGTTACCAGCTACCCCCTCCTGGAACA
CGAGGAGTTTACGTTCTACACTGCGGACTAATGCAGTGTTTCAACAACGGAGATTACGATGGCCTCTTTTTCCTTATGAAGATAGAGAGGGCTGCCAAAA
TGGCGGAACGATTCGCGATCCACAATGCACCGACAGGACAAAGGGTGGACCTGTGGAATTTCTTTTACTTGTGTCGAGCTTTCGTAAGACAGTCGTACGA
CATTTTGCACAACGGTTCCTGATTGGATAAAATAGCGCGTATTCATGAAGGCGAACAGATTGCCGAATGCAACGCTGGATCACCAGCCTGGTGAGTTTGC
TTTGACCTTCATGTTTTGAATGTCAACTATACTAGCACATCGTCCGTCCCCTTACTTCTGTTAAGAGCTGTATGCAAACCAGGGAGAGCTTTATATCATG
CTCGGCATTCGAACACTGCAGAGCAAGGTAACAAACTTCATTGAAGCGGTTAACGGTGCTTCTTCCTTTTTCTTTGTCTGATAGTCTCTGTCGTTTCTTT
CGTGTTGATAGATCACTTGTGCACACTGTGCACTGCACAGTCATCGATCGGAGGCTGCCCTGCATCTTCAATACCAAACCACCAAAGATGCAAAGCGTGT
ACGACGTCAACTCTGGAGAACTCAAATGATTCCGGCAGAATGTACAACTCACCGTCACGCTGCCAGAAGTGAACGGTTGTGGACGACGCTGATAGAGTGC
GTAGTGTAGCCATGTTCCGTAAGTTGGTGTCTTCCTCCCAGCACCCTACGCATTTTACTTTCAAGTTGCTGTTAGGTGCTGCCACTGCCGAAAACTACTT
TTCCTTCTATCCTGATAACAGTCGCATAATTCGTGATGCCAGCGTTTCCGATAGTCCGCGCACAACGGTCTGTATATTCTCTTCATGTCCAAACATAACC
ACCTGGTGTGGAATACTGGTAGCCGTAAGCCAGAGGAATCGTCACGTACAAGCTGCTCTTTGAGGCGCAGCCATACACTCGTGAGCCGAAGAAGCGGTGT
TGCACGCAGTGCATGAGTAGCCGGCAGTTCAGTTTGAAGATAGTTGAAGTGAAATACCAGCGACACCAAACACAATTTGGGTGTTTTCAGCCAATCACAC
GTGAGTACGACAAATTGTCTTACGTTTTGTGCGTCATTTTCGATATTTGCCAATCATAGCGAAGTAAAGTCAAAAGCTGAATGATATTTCTATTGATGGC
CAAAAGTTCTCTGGATATTTATATCCAGAGTTTGACAGAGATCTGAAGGTGGTCTATTCCCTTGCTGAATTTATTTTTGTTTTTATAGAGTTGTCATAAG
TTGTACGAGTAATACAAAATACTCTATAAACAGATTCCAAAATGTTATAACCTGCTCAGATATTCTAATTTTAGTGAATGTTCACCCAGGCGGCCCCAAA
CGACATTCGAGCAACAATGCATCTGTGATAGGAATCAGACTACCGTCTTACCGCGCACCAGGGCCCTATGCATTCAAATAAAATAGAAAGCACACTAGGT
GTTGTATTCCTGTATAGCACCTAGGCGTTGTAAACAAGGGAGCTCCTTCAACGAGAAGACTAAGGCAATGACGAACATCAAACTGTATTATAGATGCATC
CCGTTAACCTTCAAGGTGAAATATGGACCTAAACGAGCGATATGTATGGTCTGGATAGCATTATCAACTGTGTAGGTGAAAGAGCCGATTACCTTGCAAT
CTTCGCCGAGTGTCGTCACTTCAATATCGCAACAGTGCATTTTCGATGCAGCAAAAAGCTCCAGCCCCCCCTGGTGATACGTCGCCACCTCTTAGCCCCT
CTAAATACGAGTCGTCAAATAAGCCATCCAGATCTTGGAGAGACTCCATGTACCGTGTCAAAACACCGACGTAGTCTCCAATAGTGGCTCCAATAGTGGC
TCCAAGACTGTGCCTCAAACAGCAAAAAAGACTCGTGCGGATGTCATCTGGCAGGTACCATTCCGGCGCTGCAATACACAGCTCTTCTCTGTCATCATTT
TCATCCAGAAGGCGCTGGTATCGTTGGTGCCATTCTTCCGTGCTGATAGTGCCGCTGAGTAGATCTCTTAGAGGAGGATGTAGCTTTTCCTCATCGAAAG
CCGACCTTGCCACGAGGCCACAAAGCTGAAAGGATGCTGCGATCTGGTCTCTACGTTTGCTTGCTGTCCATTGTAGCACCCAATCTGCTACAAGCTTGTA
ACTGGGAACTTTAGGATTGCCGGCACGAGTCTGAAGCGTTGTGTCCTGTAGAGCTTGGCCAATATAGACGTCGTACTGATCGCGGTAAAATGCCTGGAAG
CTTCTGTTTACTGCAACGTCGAGGGGCTGGCATAGGTTCGTAAGGTTGGGACGGACAAGCAACACAAATATATTGTATCTGCGTAGATGCTGCTCGTTGA
ACAACTTGACGTGCGCCGCGTAGGAGTCGATGATGTATAGCACAGGCTGTCGGTAAAAAGCTGTCTCACTCCTGCTACAAATAACCTCCTTCGCGTGGCC
GAGCAAAATTTCAT