Description :
From Genome Similarity Track
Location :
contig_47:307693- 314294
Transcript NameFunction/comments
g9696.t1hypothetical protein
g9697.t1XP_009523397.1 hypothetical protein PHYSODRAFT_542020 [Phytophthora sojae

Sequence
6601 bases(100 bases per row)
GCTGTACACATCATTCACGGCACGCATGGTACGCGAACACAGCGCAGTCTGAAGCGCTTCCCAGGTGACACCAAGCATCTGAGTGGCAGCATTGGCACCA
CTGTCGCCTTCGATAATGAGAGACTTCTCGTCATCCGATGGGTCGGACTGCAGTTGCGCCTCACCAAGGTGGAGCACACCGGCAAGCACCTCGAATAGCG
GCCGCTGATCATCGTAAGACAGACCCACAAGCTCCAGCGCCTCACGCGTCTTCTTGAAGTGCTTCTCATCCGAGAGTCCTTCGATCTTCTGTGCTGTGTT
GTCGCCAGTGTACACGTAGTGCTTTGCCGAGTCGAGGAGCAGTTCCGGCGCAATGTCGGAGCTATCCAGCAGTTGGTAGAAGATGTGGTAGTTGCGCTCG
GGCGCTTCGTGCTGAATGACACGAGTCTTCTCCAGCAGGTACGTGCGACACTTGGCACCAACAAGCGTGCCGTTCTGGTCGAACTGCAGCTGTGTGAACT
TGCCGAATCGACTGGAGTTGTCGTTACGCACAGTCTTCGCGTTACCGAAGGACTCCAGCAGCGGGTTCACCTCGATAATCCTCTTGATGGTCGAGTTGTT
CATACCACCAGCAATGGTAGCCAGGTGGTTCATGAGGATCTTGGTGGTCTCCGTTTTACCAGCACCGGACTCACCACTCACCAGAATGGACTGGTTGATC
TCGGAGCGGCGCATGTTGTCGTAGGCCGCCACCGACGTGGCGTACACGTGCGGCGGAAGCTCCTCCTTGGGCTGGTTGAGGTATCTCAGGTGCTGCTCCT
CGGCGTAGAGGTCTGGCAGCCACTTGTACGGGTTCACGGCGATGCAAATGTCGCCCGTGTAGGTGTACGGCAGCTCGCAGAGGAAACGCTTCTTGACATT
GTACAGGATGGCGGCCTCGTGCAGGTAGTTGAGCGTGATCATGTCCTCAATACCCTCGGGCCCGACGTTCTCGTTCTGGTAGGGCAGCGACTCGAGCTGT
TGCACGGCCAGCAGCGCCTTGGTCTTCTTGGACAGCATGTCCACGCAACGCTCCTCGGTTTCGCCGTCGGGCAGCTCCACCTTGCACGTGATCTTGCGGA
TCTTGCCGTCGCCCGAGTTCTCGTCGCGAGCACCTCGGCTGCAAGCCATACGTGCGTCTCGTCTGGCACGAAGCACTTGGCTCCCACCACCATCTGCAGG
TCGCTCATGGTGTCGTCGAAGTCCCTTGGAGGCTCCCCCTTTAACTCAGGCGGAGAGGTGCGCGGCTGACGGCCCAAAGCGGAATGCGGCAAGGGGGGCC
AACGCACCAAGGGGGCAAGATACCGGTAAATGGAGCCATCTTGTCAACGAGCAACTCGACTAACTTGCGATTTGTATGAGTTGCTCTGATCGGGCAACTA
GAGGTTAGGGAACAGCGCAGCTGTGCGCCAACACCGGCTGGGATCGAGGTCGCCCCGTGAGGATTTGTGCACGCTGTGCCGGCGAGTAAAGGCCCGAATC
GAGCGTGCGCCACAGTAACCACGACCGCGTGTCTGCTCAGATGACAGTAATTGCGATGCGTGCTTCATGTGGTCGCGTATCCCAGCCAAAGCTTCTCAGG
CGCGCGTGCAAGCATACCACCAACATGGCCTCAAAAAAAATTGCGCCGGTCGTTTTCTGCTCGACATGATTTACCGCGAATGGTACCGGTTTTACTTATC
TTGTCACACGGCATACCTTGTTCAAAACCTCCAATAAATACTACGATGGGGTCATCGCTTCAACTTGCCTCCTCATCGATTGAGACACATTGAGGACTCG
AGCATTGGGCGCCAGGAGAGCCATACTCTTTTACTCATGAATGCGTCTCCATGTAGATTTCCAGCTGACCAGAGCGTCTAGGTCTCATTTGCTAATACGT
GGCGTTCCTGCTGGCACTTGCGTGGGTTGCTCAGACCAGATCAATCGTCATTTACTGCATGTGTCCGAACTAATACTTGCGGTGTTCCTTGTCGCAAAGT
TCCGCGTACGGGTCCACATCCAAGGGCTGGTCGTGCGGCGCCGATTTCGATATTGAGGTGGATGTGGATGTTTGCACATGTCCATTTAAACAAGAGCGCC
GATTTCAGAAATAAGTGGTGGCAAATACACGTTCTCTAGCTTCCGGACTCTGATCAACATTGTATTGATCACGGGACGCCGTAGCCCGCGATCAAGAGAA
CTCGAGATGCCGGCGTCAATTGTGATCTTGTGAGCCTACCGAATGGCGAATGGCTACATGTACAGAATTGTCGGTACACTGATGACGGCTTACCAGAGTG
ATGGTCAAAGAGCGCAATCAATGGCAATCACCGACGTCAGCGCCTCACATCCAACATGGCGTCCAAGCTGCTGCGTCGTCCGCTGCTTGCTCGCTCCTCC
TTGGCGCGCAGTTTCAGCGCCGCCACCACCGACCAGCAGCGTCGCGTGTGCGTGGTGGGCTCGGGTCCTGCTGGCTTCTACGCCACGAAATACCTGCTCA
AGGAGCACTCCGGCGCGCGCGTGGACATGCTGGAGGCGCTGCCCACGCCTTTCGGTCTCGTGCGCTCGGGGGTGGCGCCCGACCATCCGGAGGTCAAGAG
TGTCATGAACGACTTCGACAAGGTGGCGGCCGACGAGCGCTTCCGCTTCCTGGGCAACGTGCGTGTGGGCGAGGACGTGACGCTCGCCGAGCTGCAGCAG
CACTACCACGCCGTGGTGCTGGCCTACGGCGCCGCCGGGGACCGCGAGCTCGGCGTCCAGGGGGAGCACCTGCATGGTGTCATGTCGGCGCGCTCGTTCG
TCAACTGGTACAACGGCCACCCGGCCTTCCGCGACCTGCAGCTGGACCTGCAGCACGCGGAGACGGCGGTGGTCGTTGGCCAGGGCAACGTGGCCGTGGA
CTGCGCGCGCATTCTATCCAAGAACGCTGACGAGCTGGCGACGACGGACATCGCCACGCACGCCGTGGAGGCGCTGCGCAACAGTGGCGTCAAGAAGGTC
TTCCTGGTGGGGCGGCGCGGCAGTGCGCAGGCGGCGTTCACGATGAAGGAGATCAGAGAGCTGACCAAGCTGGACGGCGTGGCATGTATCGTGGACCCGG
AAGATCTGAAGCGCAGCATGACGCCCAACTCAGAACAGGAGATCAAGGAGCAGCGCGCTCGAAAGCGCATGAGTGATTTGCTCGGCAAGGCGGCGGAGCG
ATTCGCCGGCACCATCGACGCTGAACGCGTTGTGCAGATCAAGTTCTTGAGTTCGCCTGCAGAGATTTTGGCGGATGAGAAGGACCCGACTCGAGTGGGA
GCGATTCGCGTGGAGAAGACGAAGCTGGAGGGCGAGCCGAACCAGCAGCGTGCGGTTGGGACTGGGGAGTTTGAGGACATTCCGTGCAACCTCGTGCTTC
GCAGTATCGGCTACAAGTCGCTGCCCATCGAGGTCAACGTACCCTTCGATGACCGACGCCATGTAGTCTCGAATGAGCAAGGACGTGTTGTCGCAACGTC
CGTTAGCGGTGAAAAGCAGCCCGTTGTGGGCCTGTACTGCACTGGTTGGGTGAAGCGTGGCCCCTCTGGTATTATCGGCACCAACATTTTGGACGCACGG
GAGACAGTAAGCTGCATCGTCGAAGATTTTGCAGCAGGCAACTTTCTTCACAGCGATAAAAGCTATGGCGAGGACTTGGGTGGATTGGAGACTGTGGAGA
AGCTCATCAAAAAGCGTAACCCAGAGAAGCAGCTAGTTAGGTGGGCTGACTACGAGCGTCTCAGTGCCGAGGAAAGCCGCCGCGGCGAACTTCTCGGAAA
GCCGCGTGAAAAGGTCACGTCTGTGGCGGAGATGCTGTCGATTGCAAAAAGTATGTGACTAGCTGCTAAGAAAACCCAAAGATGATCTGCGGCAAATACT
GAGTAGCGGTGCGCAAACACACCTAGAGAATCGATTTTTATCGATGGTAAAACGTCACTTCTTGGAGCCATTGCGCTCTTTTTGGCGAGTAAGTGCAGCA
TTCGAGGCTTTCAGTGCGCGAGTCTTCTTGCGCTGCAATACCACCACAAGTCAATTGAGATTGAACCCGTCAGCTCGCGTCCTCATGAGACTGTAAGCAA
GGCGTACCTCTTCTTCTAGCAGCCTCATCAGACGCCTGCACTCCGCTGCACCTTCAACCGTGTCGTCCTCGTCCTCGTACTGATTCATCACCCTAGATCG
AGCCTGAGTTGCGCCATGTCGCTCTTCATGTGCGTCTTGTTCATTTGCGTCGAAAGCAAAGGTGTTAATGAAAGGCTGGTTCACTCGATCACGCAGAGTT
GCCGCGTAGGTTGGTTTAGTTCTTCGAACGGGGGCGGAAACTGGCCGTGATAGTTTGCTTGCCGAAGATGCCAAAGTGGCAGAACGTGGGTGTTGCAAAG
GAAGTCGTGCTGCTGCTGTCGCCATCTATTCGCACGACGATGCATTCGGTTAAACGTGCTGCTAACATCGGCAACGATGCAAAACATTCTGCTCGTACGA
TGGCTTTCACATGCCGCAGCTTCGCAGGATCCGCCAGAATATTTGTTGGCAATGAAAAGGCTCTGGGATAGCATCACCGAGGTTAGCTGCGCCGTACAGC
AGTATCATAAGGAAGATAAACTTGAGTGGCGTTTCGCCGCTGCTCGTACCGCTGGCTTGTGTCCACAGCGCTTATGAGCCGCCCAACATACGTGTACATC
TCCAAGCAGTCCTCGCGGATATTCTACGATAGAACAGTGAGGCATCAGAGGATGGTTTTAGCAAGCTACAGCACCAACACTTTACGTACATCCATAGTAT
CAGTAGTGGACTGCTGTAGCTGTGATAATTTGCTGTTTGTAGTGTTGAGCTCCTCTGTTTTGCTTTTCAAAGACTGCTCATACTGTTGAGTGCACAACAT
TTGTCAACAACTTCTGATGCAACGCAGCTTCTGTCCAACGTACCTGCTGGCGAATGAGAGCGATTTCATTCTCTTTCAACTTTTGCAACGCAGCTACTCG
TTGGCGTAATTTCTGAGTGAGAAGGGCATGACATATATATTCGTGAGTTGACCGAGAGCATGGAGCAACGCAAACAAAGCCTGGCCAACCTGGTCGAACT
GCTTTTCTGAGGAATCGGAAGTATCCACGTGTGGATTGATGTTTGAGGCTTGATGCTGATGATAGGGAAGCTCGTTATCCACGCTGGCGCGCATCTGGTT
GTTTCGGCTGAGGAGCTCCATCATTTCTGCTCGGTGCCGGGCGGCCTCTGACGCCAAAGCGCGCTCATACTCACACGACTTTTGCTTCAAACAACTTTCT
AATGTAGCAATCCTCCGCTTCTGCTCGTTGACGACACGTCGTGCATTCTCTTTGTCTTTCTTTGCTTCAGTCTGGAGATAGTAAGATTACGGTCGTCAGC
GAATTGGAGATCAAGTTGCCGAAGATAGCCATTCCTCAACTCACCACGACCACAGTGAAATTACTCTTTGCATTGGTGTACTTCTGTCGTAATCGATCCC
GATCGGTCCTAGCATTCTCTGCTGTTGCGTGATTCAAAAGTAAAATGACGGGTGTAAAGATTCATAAAATTTGTTCTACGATACCCAAACAACTCACCGT
TGGTTCTCAATAAACCTTGGACGTGCCCTGCAGGCCCAGTGTGCCTGTTCTTAAGACATGAGCTTGAGGTTACTGTACGGTCCCCTTGGTCTTCATCCGA
AAACACTGACTTCAGCACGAGTCCGTCCTACGTTCACACACACATAGCAGAACTGCTGGGTCAAACCAAATATTCAACCAGTTAGATATGTGCGACCTAC
TGCAAATTTGATTTCGCCGTTTTCCGAGATCTCTTCAGCCTGGAAGCCGAGTTCGTTCAGTGTGGAAACAAACTTATTGTTGTATTCCGTGCGCAAACCC
TCAAGCTGACGGCGCAAGACGCTCAGCTCTTCTTGAAGCTTACGGATACGCCGATCCTTGTCCACAATTGTACCATTTATATGATTTACACGGGGCTACG
CAAATGCAACCACCAGGTTAGTCGCAGCAAATGAAGAAGTACGTTTTGCATTTACTTACCTGGTTCTGCACGGAACGGCACCGGTTGGCAAACTGGAGGG
TTCCCAGGCATTCTTCATAGTGCTCCTTCATCGGATGGATAGTTGCAATAAGTGTGGTAAAACAATTTCCTCCTGCAGCCAAAAGTACAAAGCAAAGGCA
AGTTAATTAAGCAATGCAATCAAGGAGTAAATTTGCTTCATGCACGAACCGATGCTGTTCTGTAGAAGTCGCGTTAGTTTCGAGTCCCGATAGGGGATGT
AGTTATAGCCGCTCTCTGGATCTAGTGACATCACAACTTTGCCCACGGCACTCAAGCTCGAGTTAATATGCAATGCCTCCTTGAGGCGCTGGCCATCCGA
CTCGCTCTTTTTCAGGCGCTCAGACCTAGCACCACAAGAGCACCGATGTCAGAAACGCAAACAGTTGCTGGGGGCTGCTTCAAAAGGACAAGTATGCACC
CTGCTAGATCCACCATGTTGAGCATTCCGTATATCACTTCCTCGGTGTCTCGAACTTTACCCACGCCATAGAACCCAAACAAAATCAAATTCAGGTTCTG
T