Description :
From Genome Similarity Track
Location :
Scaffold_110:3076- 8039
Transcript NameFunction/comments
g18600.t1hypothetical protein
g18601.t1XP_009538498.1 hypothetical protein PHYSODRAFT_248094 [Phytophthora sojae

Sequence
4963 bases(100 bases per row)
AGGCCCACCTACCCTAGGTTTATGCAGTGAAACCATCTTAAAGGTTAGTCTTGGAATTTGTATAATTTATGCTGACCATCACTCTTACCGATGCATCCTG
TCAAAGGCGTCGACATATATCTTCTGACGCGCCGAGGAGCCGCTCACTCTTGAATCGGCCCCGAAATCGCGAAGACCGCTCAAAAGGTGAAGTGGGTACG
GATTGCCGTTTTGATTATTAACCTCTAACGTTTGTTTTTGTTTCTTCTGTTTCTTCTGTTGCCTCAATAGAAGCCAATGATCCACTTACAGCACTTGGCC
ATTCACTGGCGAGTTCGCTGCGTGCTGGACACGTCCAGCAGCGAGGACGAGAACACGCCGCCGAACGTGGTGCGTGTGGAGCTGACGTAGCTCAACTCCG
GGTCCTCAAGCAATACTGGTGGGATACACAGGAAGACACCGCCTCCATCACCTCCACTGGGACGTTGACCCCGTGGCTTCCGCCGGGCACGTCACAGCTT
GGTCTGACGAAAGCCGAAACAAACCTTCCGTCGACTTCCACACACGAAACTCCGCGACCCCGTAGCCTGACGATATCCTCGCCAGTGATGCTGGACACAC
CGCCAAGGTCGCCACTTCGAGAGCTGTCTCCTCCCTCACCGCGCCAAGACCGCCGCCAAGACCGCCGCGTGGCCGCCACACCGTACTGTCACCCCCGCGT
TACGTCTAGACAGACGGAGAACCGCCGCCGTAACCCCCCCCCCCCCCCCCCCCAATCATCAAAGACTGCTTCAAAGATCGCTGAGACCCTTCGTCCGTCG
CGGGCTTCAGCTCTTGGTTACGTCATGGCTCTCGCGAAATGGCCCAGTCTCATTCCCCAGTTGCGGGCGCAGTTCGACCCTCTAGCCAACGTGTTCCCGA
TCGTGCCTCACTTTAGATGGTGCTCATCGCCTTGCCGGACGGATCGGTGCTCGAACATCAAAATGAAACTGTTTTGCAACGTCAATTGTTGCCCCTTCGA
CGGCTTGTGTGGCAACGGACTCGCAGAGTCCGACAAGATCTGCCTGATGCGTAACACGCGCACGTCGTCGCTGAGCGTCGTCGCGGCTGCGGACATTGGA
CCAGGCCAGGTGTTGGGCCAGTACTTGGGAGAGATGGAGCACGTCCTCATCTCGAAACGCGATCGTCCTCCCAACCACGGGTATCGATTGATGGTGAAGA
CGCGCCCGGAGTTGCTGGCGAGATCGGTGGTAGTGGCGATCAACGCCGAAGGAACGGGCGGCTTGATGAGATTTGTGAATCATTCGTGTGAGCCCATAGC
CGAGTTCCGGGAGGTCAGCAACGGGCGCCGCCCCTCGGGCGTGGTTGCGACGACAGCTTACGTTCGCCAAGGACAGGAGATCACTGTGAACTACGTAAGC
GATCTCTGGCTCATTTGCCGCTGTGGATCCCACGTGTGCTGTCACCGCCACCACCAGGACCATGCCGATCTGTAGCAAGTGTCGAGCAGCGAGGACATTG
AAGGGCGAGGTGACGGTTGTCGTTGTTTGATTTGCAATGCACACGTATCCGTGGTGAAGTTGACTGATTCGTATTCCGTTATCTTCACGAAAGGTTGCAT
TCGCAAGTCACCCGAGCCTCTTGTTGATTTTGACGCCAAAGCCGCCAGCTCCTCACACCGCGTCAGAATTTTCTGGCACTTCAAGCCTTCGCCGCGCCCT
ACAATTTGACATTTGGCACGAGACTTTCGCGCCAAGAAGCTTTCGTCCCGCTACTTTGAGTCTAATGCTACAAACGTGGGTGGGAAGACGGTCTCCGACG
CGGGAGTCGTCCTTATCGCTCACTCTTGGCTTCTCCAAGTACCCGACAAGCCCTCCACCACCGCCCCGCCCTAAGCTCTTCAACACCTTCTCGCGGTACG
CCACACAACCGCGACTCCGCTCTACGTGCCATACGACCGTAACTCTGTTCGTGTTGTCGTTATTAGATGGTCAAGTTGACCGGAAGCCCGAACTACAAAG
TGCCCAAGATCTGCCGCCTCTTGGCGGTCGTCGAGGAACTGTTGCCGCTCGGGCGAGACGAGTGGGAGCGCGTCACGATCGCCTACAACACGAACCGGAG
TCGTTCGAGGGCCGAGCGAGACCTCGCCAGTCTGCGTTAAAAATTCAAAACTCTCCACATTGCCAGGAAGCCGACGGGCACGGCGGAGATACCGCCGCAC
ATCAAGAAGGTCAAGCTCTCCAAGCTGGCCATCGACGACAAGGCAAACGTCGTGGAGATGGACGACGCCGCCGACCAAGACCTAGACGAAGACCATGCAA
TCGGAGACCAGCGCTTGTTCGTGGAGCCGGACTTCGGTTTTGTGCCGTACTACGACGACCAAGAGGGACACGGTGACGAGGATTTCGTTGGCAGCGATGC
TGCAAGCACCAACCAGTTGGGCAGCGACGAATCCCAACCCGGTGACACTACGGATGCAGCAGTCGCGGACGCCGTCTTTGCCGTCCGGACCCCACTTCCT
GCCGAGGCCCCCGGCACCATTGACTTGCAACTTGGCGCCGAGGGTCTCGAGGCCTTTGCCTCAACACCGAAGGCTGCCACTCGTCCTGCTGGGCCGTCAA
CTCGGCAACTTCGCTCTGTTGGATTGAAGAAACCGATGAAGACCACCGCCGCTCGTTCGTGTTCCGCCGAAGACACGGCAACAGCGACAACCACTAAGGT
CACCAAAACGCCGGCTGCTCGGAGATTCCAACCCGGTGGTCGCGATGGGCAAGAGGCCTACCGCCACATATCGTTGCAGAGCGCTTCGAGCCTCCACGGG
GGCAACAACTGGTACGCCATTCGCGACAGTGTCGGTTCTCAGCGAACCAAAGAAGGTATCGACAAGGAGCATGCCGAGGCGAGTTTCGCTTAAGCCAAAC
GCATGCGCGCGACGAAGGCTTCCGCCGCGTTGAAACAGAAGCTGACCGACTTGGATAACAGTAACAACAACCTCAGCAGCATTTTCGAGATGATGATGCT
GTTCCGTGAAGAACACGAGCGGAAGCTGGAGAACCGCCGCGCCGAGGAAGACCAGCGTCGCCGGGAGGAATCTGCTGCGAAAGAGGCTCGACTGCTGGCG
GACAAGTCTGAAGACGAAGAGCGTCGCCGCCAGGATAAGCTGGAAATGGACGAGCGTGCGCGACGCGATAAGAAGGAAGCCCGCGCGGGCACTCAAGAGA
TGGTGTTGTTGATCGGGGCGATATTCAAGAAGTATTAGGTTTGGAGATTTGCTATTGAACGGCGTCGAGGACGGCGAGCTTGTACACGGCACTGACTGCA
ACTACCTGCAGCTGTGTATTGGAGCTGTAGCGAGCTACGGACCGAGAAAGTTTTTGGATTGTTCACTTGTAGCGTTGTAGTACCCCAGGCGTCTAGGCTA
ACTTCAATATAACAGCAACTCATGTTCAAAGTCGAATTGTTTGCGCTGTGAGGAAGCATGCTTTCTCGAGATATCGGACACACGAGCACCACCAGCAAAT
ACAGAAGCAAAGACCAAGGTAAACGTGTTAAACGGTATATATTGACTCTGCTTCGACGACCAAATGAACAGTTACGTAGTGTGGTGTAGGGAAACTCATA
TTTTGGGTAGACCACCCATTCTGGCCCAGCTAAGTACGTCGTACCTAATCGGAGTTCGCACCTAAGCGGCGAACTCGGCGAATCGGTCGGACTCGGCGAG
CACCAAGACTCAGCGACTCAGCGAGCGTATTCCACTTGGGAGTTATTCCAAGTGGGAGAGGATAAATCAGGAATCGGAGCGAAGGGTCGGCCGAGATCCA
TAACGACCCGACTCGGCGAAGATCAACTAGGAAGCTGAGCGAAGAGTTGCAGGGAGATCTATAACGACTCCATTTCACTAGGTATTTGTATAGGATAAGA
TAGGAGACCAAAAGGGGGAGCCCGAAGGGACTCCCCGAAGACACAGAGATAACAAAACAGAGCAGAATCTTCTACGTCCAAGAACAGCGTATACTTTCCG
GTAAGTCCCTGCGTGGGCTGGATTATGTCTGCCGTCGTTCCCCGAGAGGCATAGCTTGTAGGGGAATCGACTGGTAGCGCCAAGAGATCAAGGTCGGCCC
GGGGTGGGCACTTCTCGCTACCAGCGAAGACAAACCTCGTCGAATCGACGAGTCGGTGGGTCTGCACAACCCAGGACACCGCAATCTTCTAGCTGAGCGT
ACTCTGCGCTCGGTGACCTGTAAAAGCGCTCGCGCGCCGACGTCCATCCTTTGGTGGAGGTCACAGGGTTTGAGGAACGGAAGCTGCCCCGCTCAGGCGA
GCTTCTGGAGTTTGGATTGGTACTCAGCGAGAGTAGGGCCTCAACTGGACCCGGCTGGGCCGAACCGCAAAGGGAACCAACAGAACCCTGCGCAAGCCCA
ACAACGCCGACCTGACTCGGCGAATTGTTGTGTTGTTGCGTGGAAGCCGCACTAACGAAGTTTTTGTGAATCACAACACCACAACTGGTGCCGCGACCCG
GGATTCAGGAGTGCGCTTTGTTTTCGTAGGTACCAAGTAACCAAGTTTCGAGCAAAAAGTGAGAGAAGATGGTCAAGGGATCGACAAGTCCGAGCGACGC
AAGTCCGGCGACGGTCGGAGGATCGCCGCTCGCTGAGTCGAGCTCGACGAGGGCAAGCGTCGCCGCCATGGAGGCGGATGTGACGCGGACCGTCCAGTTC
GATGCGTTCGACGACGATGACCAAGGAAGAGAAGAAGAAGAAGAAGAAGAGAAGGATGATGATGATGAGAAGACGGGGTACGACGGCGTGAAGACGGCCG
CCGAACTCCGCGAAGAAGTGGAAGAAATGTCGCTGCAAATCAGCCGCGTAGGGAACCCTCGACCTGTCGAGCGCAGCCTAGCGGCGGAACTCAGCGAACA
TGCTGATGATGAACAAGGCCTGGCCCCGGGTGACCGACCGCCACTGGTCCCGAAGGACACGAG