Description :
From Genome Similarity Track
Location :
Scaffold_66:30757- 32354
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_66-snap-gene-0.26U4/U6 small nuclear ribonucleoprotein Prp31

Sequence
1597 bases(100 bases per row)
TCGACCAAGAAGCACTCACAAGGCAACATGTCGTCCGTGGCGGACTCGTtCCTAGATGACCTCGATGAGCTGAGCGGTgACAGCGGCGACGAGgAaGAGC
AGCTGACAaCCGaGAATGtGTCTGCTCCcGCATCTAAGAaGCgAAGGcTCgAGGgCgTGGAGgAAGGAGAaGAAGAAGAGGACGACGACGAAGATgAGGG
CGATGCGGATAAGGGCgAGGGTGAGATGGAGGAGGACGCCGAGGACAAGGCCGCCATTAAGGATCTAGACAAGGTGCTAGAGGCTGCTGCAaGGgAAAAG
GCGTCGAGTCGATCGCGCATCTCAAGCGCTCGGCCAAGTACCTGGACCACGTGCGCACGATCCAGCAGTTCGCAGACAAGACAGCGCTTCTCTGTGCCGA
CGAGCTCATGGAAGGCAGCGACGAATACAATCTCGTGGTGACGTCGAACGATCTCATGGTACAAATCGACGACGAGATCGCGGCCATCCACCGCTTCATT
GCCGAGATCTATGCCAAGAAGTTCCCGGAACTTGACTCGCTCGTGCCAAGTGCTCTtgACTATGCCCGCGTAGTGAAGGCCATCGGAAACGAGACCGACA
TGACTCTCGTGGATCTGTCCAAGCTGCTTCCTAGCGCTGCTGTGATCAGCATTTCAGTGACAGGATCCGCGACTAGTGGCAAGCCACTGGCTCCAGAGCA
GTTGAACACTTGCATGCAGGCATGCGACGAGCTGCTGTCGCTCTCAGAAGACAAGAACATGAttctGGGATTTGTTGagAGCCGCATGAGCTATTTGGCA
CCGAACGTATCCCAGTTGGTTGGCACACGTATTGCTGCGCAGCTCGTGGGTCTTGCCGGTGGCGTTGCCAACCTGTCGCGTATTCCGTCATGCAACTTGC
AAGTGCTTGGGCAGCAGCGAAAGGTGCTGAGCGGATTCTCGTCTGCCGCCGCCCTAAAGCACACAGGAGTCATCTACTATGCAGaGTTAGTGCAGAGCGT
ACCGCCGTATTTACGTATGAAGGCGTGTCGTGCCTTGGCGGGTAAGATCGCACTCATGGCACGAGTCGATAGCCAGCCACACAAGACGGACACAATCGGC
CGTACCGGCATCCAGTTCCGTGAAGATCTTGTCAAGAAGTTCATCAAATGGGAAGAGCCGCAGAAAGCGAAGACTAAGAAGGCACTGCCGATCCCAGATG
AAAAGCCAAAGCGCAAGCGCGGTGGCAAGAGATACCGTAAGATGAAGGAGCGACTTCAAATGACGGACGTGCGGCGAGAGCTCAACCGCCAGACGTTCGC
GTCAGCCGATGATGAGTATGGCGATAACGCGATGGGTCTCAGCAGTGGTCGACTGGGACAGGAAGGATCTGGTCAGCTTCGCATTGTTCGCAAGGAGCAG
CGCCAGTCAACCAAAAAGTTGCGTCAAGCCAGCGTCGCCGCAGCCAAGGCCACGCCGCTCTCGGGCCTCGCCTCGAGCTTGGCGTTTACCCCcGTGCAGG
GCATCGAGCTGGTGAATCCAGAGGTAATGAAGAAGCGTGTCGAGGAAGCCAACAAGAAATACTTTtCGGCGACAAGCGGCTTTGTCAGTGTCGTgaa