Description :
From Genome Similarity Track
Location :
contig_14:307525- 308758
Transcript NameFunction/comments
g2970.t1hypothetical protein PHYSODRAFT_557686

Sequence
1233 bases(100 bases per row)
CGCAGCGGAGGCAAGCTCATTATCTTCCTGGTTGGACTGCCTGGTCGTGGTAAGACGTACATTGGCCACATTCTGGCGCGTCACTTGACGTGGATGGGCC
ACCAGTCGCGCACGTTTAACACTGGAGAATACCGCCGAAAGCTGGTTGGCTCGAACGTGAACCACGCGTTCTGGGACCCGTTCAACGAGGAATCGTTCCA
GATCCGCACCGAGCTGTCGAAGAAGTGTCTCGAGGACTCGATTGCCGCGTTGGAGAGCAACGACTGCGACTGTGTGATCTTTGATGCCACGAACGTGACG
CGCAAGCGCCGACAGATGCTAGTGAACGAGGTGCACCAGCGATACAAGTGCGAGATGATGTTCATCGAGTCCGTGTGTGATGACCCGAACCTCATCGCAT
CGTCGATCAACGAGATGAAGTTGAACTCTGCAGATTACGCTGGCCAGACGATGGAGGAGGCAGCAGAAGACTACAACAGCCGCATCAACCACTACCAATC
GCTCTACGAACCCCTTGCGGCGGACCTCGAGGGCGCGCCGTTTATTAAGATCATCGATGTTGGCCGCCAGATCTTCTGCAACCAGGTGTACGGCTACTTG
CAGTCGCGGATCATGTTCCTGATGGCGAACCTGAACCTGAAGCCGCGACCGATCTGGCTGAGCCGCCACGGTGAGAGTATGTACAACACACAGAAGCGCA
TTGGTGGCGATGCGCCTCTTAGTCCACTAGGAGTGCAGTACGCCGAGCAGCTAGACCGGTTTACTGACGCGTACTACCCGACACCCGACACAGAGCTCGC
GGTTTGGACCTCGACGATGCTGCGTACGGGGATGACCGTAGAACGCATTGCGGCCCGTGGTCGGTCGATTGTGAAGTGGAAACAGCTAGATGAGATCGAC
GCCGGTATTTGCGACGGCATGACGTACGAGCAGGTGGCCGAGGAGATGCCCGAGGAGTATCTGGCGCGCAAGAACAACAAGCTGCACTACCGCTATCCGC
GTGGCGAGTCGTACCAGGATGTGATCCACCGCCTCGAGCCGGTCATCACGGAGCTCATGCGCATGGACCAGCCCGTGCTCATCGTGGCGCACCAGGCCAT
TCTGCGCGTGCTGTACGCTTACCTCACGAACAAGTCCCCGTACGAGTGCCCCACGCTCAACATCCCGCTGCACGTGGTCATCCAGGTCACGCCCAGAGCC
TACAAGTGCGAGGAAGTGTGGCACCGCCCCATG