Description :
From Genome Similarity Track
Location :
Scaffold_52:30745- 31969
Transcript NameFunction/comments
Physo_137213hypothetical protein
Physo_109008pol protein

Sequence
1224 bases(100 bases per row)
GTACGGCTTGAGCAAGCCCACGTAGACGACGGGGTGCGTCCGCATCTTCTTCGGAAGATTGAGTGTGTATGCAAGGCCCTTCTTGGCCACAACCTTGAAA
AGGCCGATGAAGCGCGGGCGCAACTTCGTCTTGAAGACGGCTGACACTGCATGTGTAGGTAGGTTCTTAGCGTTAAGCAGCACCAGGTCCCCGACTTCAT
AACTTTCAACATTTCCTCTGCCTCTGGCATCTGCATGTTCCTTTTGCTTGTCTTGGCTTTCAGCCATTGCGTCACGCACATGTCGTAAGACACTGAGACG
CGTCGACAAGAAAGCGTCACCCTGTTTACGAACAGTAGCCGGGCTGACATCGGCTAGCCAATCAGCTAAGTCGGCTTCTCCTCCCCCACCAAGCCCGAGG
CCACCACGTGGCGGCGTCAGCGGGACGACAAGCTGTTCACGTAGAACGGCGTGTAGCCTGTCGAGGCGTGCACGGCGTTGTTCAACGCAAACTCAACGAG
TGGGAGCATGGCGCTCCAGCGCTTCTGCGTCTCGGCGCAAATGCTTCGGAGCACGTCCTCGACGACGCGATTCACGCGCTCTGTCTGACCATCGGTCTGC
GGATGGCCCGCCGTGGACATGTCCAGCTTGGTGCCAAACACCGCAAAGACCGCGCTCCAAAAGTTGCCCGTGAAGCGGGGGTCTCGGTCCGAGACAATCG
ACTCCGGGAGTCCGTGTTGTCGAAACACTCGGTCCAAGAACAGCGTTGCTGTACCTTTACCATCGATGGTATCCGGCACAGCCGCAATGTGAGCCATCTT
GCTCGGTTGGTCCACGAAGACCACGACTCCAGTGTTGCCCGCCGCGTCCGCCGGCAGGCCAAACACAAAGTCCATACTCATGGATTGCCAACAGCCCGAA
GAGACAGGCAAACTCGCCAACGGCGCTGCAGCATGAGGTGACGACTTCACTCGCTGACACGTCTCGCACGTGCGCACGTAAGTGCTCGTCCACTTGTGCA
TCTTTGGCCACCAGTAGTGGGTGCCCACCGAGCTGTAGGTCTTCTCATGGCCAAGATGGCCGGCCAGCGGCGTGTCGTGTGCCTCATAGAGGATGCGGTA
CTTCAGATCCTCATCATGAGGGATGACCACGCGGGGCGTATCCTCGGGGCCACTGTTGTAGAACAACAGGCCTCCATCGAGGGAATAACGGTATAGCCGC
GCGTGCAGCCGCACTGACAGTTCC