Description :
From Genome Similarity Track
Location :
Scaffold_117:3074- 5497
Sequence
2423 bases(100 bases per row)
TTTATCATCTGGGCGACTGTTCGTGTGGATTGTGACAGATGTCGCAGAATGACGGGTGTGTCAGTTTAGCGTGGATGATGAGTGTGTCTGTTACTGATGT
CACTTTAGCATATTGTAGATATCACGATTGTGTGTGAGAAAAGGAGTTGAAAAGATATTGGAAAGGTCGAAAGGTCGGTAGTATAACAAGATAATAATCA
GTATCAAATTTTATTCTTGTAGCGGACCCGTTTCCTTGTCTGGCGACAATTTATAAGCCCAAAAAGTTCAAATAAGGGAAGTGATGATGGTGTGGTGAAG
TGCTTTCGAATAATATTGGACCTGGAGACTATAGAGACGAGGGGACAAGGAACAGCCTTCAGGGACAAGATAGAGACTTCAGAGAAAGGGTGCTTGAGTG
AAAAAGGGGCCACGAAAGTGGTTAGAACCTTAACGAAGAGGGGCCCTCAGAACCAACCAAAGAACAGTCCGTGACCCGAGTACCGGTTAAGCGGCTCTGA
AAGAAGATGACTGCAGACCCTCATCGGTGGGCCAGGTCTCCAAAGGTAGACCGCGGTCCCTCATGGGTAGACCAGGATTCCCCATCGGGTGACCTCGGTC
CCCCATCGGGAGACCTCCGTCCCTCATCGGACCCCGGTCCCCAATTGGTAGATCAAGGTACTTCAATATTTGGCTGCTCCTGACCAGTCAAATAAAGAGC
CAGAGTATGAGGCAAGGATAGAGTAAAGAAGTTAAAGGATAGAAGGATATTAAATACTACTCAAGATGCAATCCACGTGGCACGACTTTGTCGTGCGTTA
AGGAACTTGTTAAGTTTACCCGCCTGTTCCGGGGAAGGAATATACTTTGCCCCCCCCTTGAAGACCGTTGTGAGATAAGACTCAGGTGCAGATAGAACCC
CAGGAAGTATTTGTCCTGCGGGTTCGTCGAGTAGCAATACCCCCTCAAGACCCACTATCGGAAGCGGTCTCCCCACCACGCGGTTAGGGAGCAAAGTAAA
GGCCAGGAGGTTAGCACCCCTGAGACTACAAGGACAAGGCCAGGAGCGACAAGCTACCTGAAGAACTTGGTTAAATGTCCACTCTCGGCTGAGTCAATCG
AATGGCCACCTACCCGCCCACCCATTGAAGCATATCCATTTGTGGCCTCGGTCTACATCTATCTAGACCAAAACATCCTCTTCTCCGTCCGAGTCTACCG
AAGAGTGCAACCCGCCAGCCGACGGGTACACAAGGGGAGTCAAGGTCCGTATGCGGAATCGGGGTATCCCCCGTAAGTGGGCAGTCCTACACAGTGAGTG
TTTTGGGGGCTCAACACGCAGTTTTAAGAACCCTTTCCACCACAATAGTGCGCGTGCCCATATCTTCGGAAGACACGGGTGTCGTAAAGTGCTTCTAAAA
AGACAATGGACCTGGGACATCATCCCCAGCCTAGCTATCCACGTACTGTCATCTCCCTCTATACCGTCCTTGTTTGTCCACCCCCTATTTGGATCATATA
AAGGGAGGATATTATACCAGAGGATGTTATACAGTCAGCTCCCTCTATAACATCGCTGATTGTCCACCCCCAGTTTGGATCTTATAGAGGGAGGATGCTA
TACCAGGGGATAGTATAGAGGGAGCTGAATGTATAAAGACGGAGCCACAGGTGCTCCTTTGATACGAAATACATCTGTTGAGGTTTAGATAAGTCTCCGT
TTGCTTGACCGCTGTCAACATAGTAAAATCAATAATAATAGGGAGCCGGTACACATCATGTGTAGAAACGCGTAAAACTAAGTAATTTAAGCAAAAACCT
AAAAACAATTTACAGTCTCCCTGTCCCTGGAAGCCGTGTTGTCACGCGGAAAGTGCAATGCCGAGAGCACAACAAGACACCAAAGATAATTGATGAAGAG
GGATTTTTAGGGATTCTTAAAATGCCCAGTCTTTTTTGCAAAATGCCCGCATTCAGACGATTACTTAGTATGTCTCTTTTTCTGGATGTATGCATCCCTC
TTTCTTCGCAAGTCAGATAATGAGAATTATAGCTTCTTTGTTTCCTTGGCAAAGTGCTGCCACAGTCTTCGTGGCTTGACGTTACGTCGCAGCATAAATA
TCCACAATCAGTCTGAACGAGGTAGCAGTACCAGGAAATGCTAATGATTAGGCCATTCCGCGTCGCGGCTGCTGAAAAACCGCGATCACAATAAGCACTT
GAGTATCTTTAATAGTAGTGCACAACCCTTGTGTGGTTGCACACTCCAGCCACTACCATAGAGTGCGCAAATAGGACAGGTTGTGGACACGTTGAGAACG
GTTATACCTCTCCTCGACCGAACAGTTATATTGCACGGGCTTCCAACTCTAGAAGAATCTCTCTTCCGCCTATTGGAGGTGGTCGGTGGATTTTGGATGA
TGCCTTACTTTACTATACGCATT