Description :
From Genome Similarity Track
Location :
Scaffold_139:3074- 5160
Sequence
2086 bases(100 bases per row)
TGATGGCCCCCTCCCAAAGTTCCATCCCGAGTTCAACCCGATAGTGCCGTTCCAAGAAGTGGAAGAGGTTTTGCGCGCAAGGCTGAGCGTTCAAGAAGAC
CAAGATATGGAAGCACGCACTTTTACAAGATCCAGGCGCAGAGCAAGCGGGCTCGAGCCATCCACGAATTTGTAGTATCAGTCAAAAGCTAAGCTTCTGC
AAGTACCTTGCATTCTTACGGCGACATATGCCGCATCTGCGCGGCAACCAAGGCCCCAAGCTTAGTCTATCAATGGTGATTTCCAGCTCGGTGCGCCTCA
AGGAAGGCGCTCAGTGGCTGGCGTCATCATTGACGAGTCCGACACCGTTCGCACGCTTGCCCGGCCCCGACGAGCGACGATCAGCTGGCGCACGCGACGA
TGGCCGTCGGGCGTGCGACGCACCGTGGTGACCTTTATTTAGCCAAGACGCCGACACCCTTCGCATCTACGCCTCCAGCGCGAGCATCGCGCACGCAACC
GCACTGCGGCCACTCGGTCGCTATACCAGCATACACGAGCAGCAGCCCAAGAGCGCGCTCAGGATTCTACCTACTACTACCAAGGGCACTGGCGATTTAC
TAGCACGCAGTATCTAGCGCCCCTGCCAATTGCGTCCCTGGCGCTCGTGGGTGAGTGCGATACGGTCCGTTTTCCCTACCCGTCTCGGCACCTTGTTTTT
TGCTCAACTGGCGCGTCAACTTCGCTCTGTGTCTGTCTACATCTACACGTTCGGCTCCGCGATCTCAGTGTGTACGACGAGGGTGCANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCTCTGTGTCT
GTCTACATCTACACGTTCGGCTCCGCGATCTCAGTGTGTACGACGAGGGTGCACTTGCCTTGGGCATTGACCTGCTCAACAACGCCGACAAGTTTTCCCA
ACAATGCGACGTCATCAGTACCGCAGCTCACAAGACGTTCGCGGTTTTTGTTCTTCTTTTCTCCCTCGCGACGGCAGCCTGCGACGTCACTGGCGCCGTC
GCAGCCGTCACAAGCTTTCCGGGCGCAGACTCGCGACCCAACTCACGGCCAGCACGGCAATACGACAGGCCATCGAAGGTCGCAGTCAAGGCGGCAGTGA
CAGCCACGCCGACTAGGCACGCTCGCCAATTCCGTCAGACGCTCTGGCTGCGCCTCTATTGATGACGGTACAAATGGTGCACCGGTGTTGACGGGCGGCT
GCGCATTCAGACGGTCGCGATAGCCCTCACTAACACCGCCCGGCGGCGCGCTGGGGGGCTTTGAGGGCGGACTTGGAGCTGTGAAGCTGCCAAGGTGGGT
ACTCGTATGTCCCACCCTAGACAAATCACGCAACTACAACCTCTCGGTTCGACAACAGCGCCGGCACCAGCGACTCTGTCGTCTCGGCGTAATCACCGCA
ACTGGTCCTGTGCGTACTTCCGGGCGAGGCCAAGCTACTCGCCACTCGGACTGTCAAGGCATCTTCGGACGTGATCGAGGCAAACGCTTCTTGGTTTGCG
TGCATCTTCACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGCGGCCGAGTTATTCGCCACTCGGACTGTCAAGGCGTCTTCGGACGTGATCGAGGCAAACGCTTCTTGGTTGGCGTGCATCTTCACA
CGATGACATGCCGTCAAGCATGATTGTCAAGAAGCGACTTGATGGTTCTGATACCAACGTCAATGGGATGGGACAACACCACACCTCCTGCGTGTGAAGC
AGGAATCAACCGACTGGATAAAGGACGGTCGACTAGGTGCCATCTGCATCTTGACAACGGTGACATCCGGGTCGAGGATAGTGTGCCGCCCGAGTTTACG
GCGTACACGATGGTTGACATTTTAGCGGCGCTCGCTACATGGCTCGACTGAACCAACCACGAGGCACGTCTACGTCTGGAGTTCAA