Description :
From Genome Similarity Track
Location :
Scaffold_473:30738- 33817
Transcript NameFunction/comments
Phyin_T30-4PITG_21628Putative uncharacterized protein

Sequence
3079 bases(100 bases per row)
ATCATGGACGTCGATGATGACGAGTTCATTGTGGGTAACGATTTACTTGTGATGCTGGGTATTAACGTCGACCAGCAACTGGAGCAACTGGCTAGCCGTG
GAGACGATGAGACTAGTGGTGATTCGATTGAGTTGGAGGCGGACGAGATGCCGTTCAACTCAGAGGGACCCTCATCAAGTGATGATGGCATCTTTGCTGC
AGTGGAGCGTTTGATTTCTGGTGCGGTGGAGAATGGTTTCCCTATGGATCGAGTTGAGCAGTTGTGTGCGATTGTGCATGCCTATGATGTGTGGCGTTTG
GAGCTACGTGCTGATCCGCCGGACCGCTGGAAGTGCGTCTTCGTGAAGGAGTTCGTCCATCCAAGTGTAAGCCGCGGAAGTACCCGCCACACATCCGAAA
GTTTCTCCGTGTATTTAACTCTCGTCTGGTTGCCTTAGGAATGGTGTACGAGAATCCCAATAGTCGTTGGGCAAGTCCTGTGTTACCAGTCAAGAAGGCT
GCGGACCTCACAGATTTGCGCCAAACTACGGACTACCGGGAGCAGAACGAGAAGACGGAGGTGATGGCGGCTGTCATGCCCATTTTGTCGCTAGTTCTGG
AGAATGCACGTGGAATGAAACATTTCGGTTTATTTGATTTTCTCAAGGGTTTCTGGCAATTGCCTCTCGCTGAACTTTGTCAGGAATTTCTCTCGTACAT
GACGGACGAGAAGATCTTCACACCTCGGAGAGTACCCCAAGGTTGCAGTGATGCTGCAATTTTCTTCCAGAAGACGATGGAAGAATGCTTTGCCAGTCTT
CTGTACGAGCATCTACTAATTTGGATTGATGATTTGCTCCTGTATGCTGACGACATTGATGTCTACCTCGAGAAGCTCGCTAAGTTCTTCTCGCTGCTGA
ATCAATTTGGCCTTAAGCTGAGTGCCAAGAAGTGCAGCCTGTACCAGACTGAAGTAAAGTGGTGTGGCAAGCTGATCAATAGCCAAGGTGTACGTCATGA
TCCTGAGCGGATCGACACACTGAGAGCCATGCCGTACCCGAAGACTGCTGCGGAGCTCCAACAGTTCGTCTGCGCAATCAACTGGATGCGTGAAAGCATC
GTGGATTACGCCAGAAATGTTGCTCCGTTGCAGAAGCGTCTTGACCAAGCCCTGGCCAGCACAAAGCGAGCGAAGCGAGCCGCTGCTGGGATCGAGATTG
AGCTCACGGAAGAAGAACGTCAATCATTCGATGACGTTAAGGAGATGTTAGCCTCGGCGGCTACACTTGATTTTCCTGAAGATTCGGCGACGACCTGTCT
ATTCACGGACGCCTCGGACATTGGCTGGTCCGTGATCGTCACCCAGGTCGTGAACTTTGATTCGAAGGTGCCTGCCACCGACCAGCAGCACCGACTACTC
CAGTGTTTGAGTGGAACTTTCACTGGAAGTCAACTGAACTGTACCGTCATAGAGAAGGAGGCGTTTCCTATTGTCATGGCTTGCGATAAGCTTGACTACC
TTCTCCTCCGACCCCAGTCATTTCGCATGTACTGCGATCACCGCAACCTAATTCATGTGTTTGCGCCTCATGAAAGTGTGAAGAAGCATATCAAGGGCAA
ATTGTTGCGGTGGGCTATGAAAGTGATGAATTTCCGCTACGTCGTGGAGCATGTTCCGGGCCATGCCAATGTATGGGCGGATATGATCTCTCGTTGGGCC
GGAAATCACTTTCCGGCAGCTACAGTCAAGCGGCTGAGGGTGGTACGTCGGCGTACGACCCCTGCCGTCCAGCCTACAGGACCGACGCCGATGAGGACCT
CTGGGTGACCAGGATATCGTTTTGCCCAACTCTTCCTCCACCTGCTAAAGAAGAAAGCCAAGTTCACCTCACCCTGTAGGCGGACGAGCGCAATGGGAGA
CAGGGTGCTACCCTCTCTGACCGACAGAAATGGGAGAGCTCACCCACCTCAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGCAGACCTTCACTCCAGCGTAC
TGCCCTTGGATCAACGGGTTCCGTGAAACGCGTGAAACAGGGACATATTGCAGGTGATCAGAGCGATGATCTTGGAGTACAAGATTGGATACAAGGATTG
GGTGTACCTAGTGCCCAATGGTACAGTCTAACCTGAATCATACGGCGGTGCCGTCGTTGGGCAATCGGGCGGCACTGGAGTTATTCACGGGCCTGCCGTG
CCCCACACCGTTGAGAGAATTCTACTCGCCCGAGAAGGATGAGTTACAAACGGCTCCTGAGTGTGAGAAGATTGACGAATTCCTGAGCAAGTTGCGTGAT
AGCATACAAGCTATGCATGGACCTGTTCAAGACCGTAAGGAGAAGCAGCGCTTGCTGAACACGAAGCGTGAGCGGGGAGAGAATCTTCTGAATTTCTCTG
TTGTTGGCTTCGTTATACGGTCTAGAGTCGATGAAAAACACGGGAACAAGCTACAGGTGACCTGGATCGGTCCCTATCGAGTGGTGCGTGCTGATGCACA
CTCGTTCCGCGTGCAGCATTTGGTGACTGAAGAAGAACTGGATGTGCATGCATCACGACTCAAGCTGTATGCAGATGACAGCTTGGAAGTGACAGACGAA
CTCTTGGAGCACGTTGCTGCTCAGGGTATTCTGTTGGCGATTGATGACCTCAAGGAGCACAAGTGGAATGACGACATCAAGGACTACGAGCTCCTAGTGG
GATGAAAAGGGTTACAGACAATCGAAGACTCTTTGGAGCCGATGCTGAGCCTGTCCAAGGAGATTCGTGTCCTGGTCAA