Description :
From Genome Similarity Track
Location :
Scaffold_1:3073416- 3076494
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00806hypothetical protein
Phypa_INRA-310PPTG_00807hypothetical protein

Sequence
3078 bases(100 bases per row)
CTTGCGACTCTCTTGACGGTATCGAAGACGGCCTCCTGTCCGATCCCAGACTCTGCAACTTCGACCCGTCGACGATCGAGTGTGCCGCGGACGCTACCGA
CAACTCTACGTGCTTGACGTCAGCCGAAGTGACGGCCGTGACCAATTTCTACAATGGTCCGAAAGATAGTGGAAAGTACCTGACAGTCGGAGAGGAGCAG
TACGGATCGGAGTTAGCTTGGTCCGGTGTCTTCGTCTCGGACTCGTACACAGGCGACATCATGAGCACCAACACTGCGCTTGCTGCCATCAAGTACTTGA
TCTTCGAAGACTATCCGGGCGATAACTACACCTTGAGCGACTTTGACTTCACTAAATCCACCATCGATCTGTTACGTGCACGCCATCCTCTTCTCGATGC
CGTGAGTTCGGATCTCTCGAAATTCCACAAGGCCGGAGGCAAGCTCATCATTTGGCACGGTTGGTCAGACCCGCACATCTCGCCGCGTACGACCATTGCC
TACCACGAAGCATTGCAAAAGACCATGGGCAAAAAAGTGCTGAACGAGTTCGAGCGTCTGTATCTTCTTCCTGGAGTGTATCATTGCGGAAACGGTGAAG
GTCCGTCTGCGATCGATTTGGTGACGCCCATGCTGGAATGGGTAGAGTCTGGTACTGCGCCCGAAGCCATTGAAACGAGCACGCCGACCAACACGGGCGA
GAGCAAGTTCGGTCAGTGGGCCAAGTCTGGTTCTGGCTCTGGCGGACCCCCTTCTGGCTCGGCTCCGCAGCGTAATTTGGAGGCGGAGGCATCTTCTTCG
GGATCGGCAGCTACGACCGTCACGCGCCCGGTTTACCCGTACCCCGCAGTGGCCAAGTACAAGGGCACTGGTGATGTGAATGATGCTGCGAATTTCGAAA
AGGGCAGTGCGCTTTACACGAAGCCCACTCGTTCCTGGCTGGGAGAGGACTTCTTCAACCCGTACACGCCCACCAAGGCATAAAACGCCAGACAGTAGTA
AGTGAGCACGAAGCTGACCCCACTTCGTAGTATCTCAAGATATTACTACTTACATGATGAGTTAAAGTGTCGTTGAAGTGGATGTACTGCTGCTGTATTT
TTTTTCCTTGTTTGCTGCCGGGGTAGACCGTGTCAGTTGTGCGTGAAGTACAACGTCGGGATGTATGCTATTGACCTCATAGATGACGGGGTCTTTTCCT
TCTATCGATGAGCCTTCCGGTACCGGCCGTGGGTCTTCTTTCCTTTGCGTAGTTACTCTTCTGGGTACAGGTATACAAGTAGCCTTCACCCAAAGACGAG
CAGAACTAGTTCCGTGACTGGCAAGAATCGCTGCAGTTACTCTCATATGTCCAAAGTGCGATGTACTACCAACGTCCGGTATTGAGTGTGAAAAGCTTCA
AAGATGCCGGCACGGGTAAAGCCGTTCGTTCCACGACAATTGCCGAACAGAAATAGTTGGATTATCAAAGTTCTCCTGCATCCGTCATTTTTCCGAAAGC
CTCGTTCGCCAGCAACAGCTCACGTCTATTGTCTTCAATGAGCGTTTGATTCCAGGCTAGAACAACGCACAGAATATAGGTGGAGGTCATCCACACACGC
TCCATTGCTGAAACAATACTTGAAATTAGGTACCTGTCTAATCTCGCATCTAACAAAACGCGGCTCCACACTTGCCGTGCACGTCAGATACTTCCGAAGC
TGTGGATGCTTCAGACTCTCCTCACGAGTCTCAACTTTGCCCTTTCAGTCACGGAATTCATTGATTCAATGCCGCCGTGCGGATTTTCCCTCCAACTTTG
ATCCAGCGACTGATTGTTTCTTGCTTTGGTGGTCCGTGACGTGGCAATTGCCGGAAATGCGCTAATATGGTCGATTGGCAGCGAACATGGACGTCGAAAC
TGTCACTTTCTCGTTGCCCGTAGGGCGTTTAGAAATGGTATTGGAGGTAGTGGTACTGTCAATGTAGCTGTAATGAGCATAGGGCGATGCAGAAGCCACT
GGAGGCTCGTCGGTGATGCTGTTGAACGTTGCTGCTTAGTTGTACAGTACAGATCGAGTTGAAGGGTGAGTTTCTAAAGACAACGTAGCCATTTCTAAAC
AATATAGCCGTGTATGATGAGAGGTCGCAAGTACAGTTCAAGCATAGCGTTTGTTGTTCATGGGCGGGGAAGGCGATGCTGATGGAGCAACTGTGTTCCA
CTCGCGCCTACGTGCCAAGAAAGAGGAGCGTATGCAACAGAGGCAGGAAGAACTAGCATTATCTCGCTCTGCAGGGTCGCACCACAACTTCGACATCAAC
ACGACTGCAGACTTGGTAAGTAGTTGAAACCCAGCCTATTGAAACTTATCCTAGACAACACTGATTGCTGCATGTTAATAGAGAGATGGTCTTGAGAGCT
CCTCGCCGGGCAGAGACGTTAATATTTGGGGCCAAACCAATGTACATCGACCGGTTGCTGCGGAGGCTGATGAAGATGCCATTAAGCGACGAGAGCGAGC
GGAAGCCCGTAAACGCGTTATCGAGTATCACGGAAGTGTTTGGGATGCAGTGAGCAGCAGCGATGTGAATATGGTGTGGAGTTACTTTCTTGTTGAAGGT
GCACCGATGCTATTGCGTCGACGACACCCAGACGCAGAGCAGGGTGGACGAACCCTACTTCACTATGCAGCATGGTGCGTATACTTGCAAATGTTGCGTT
GTGTGTATTAAAGCAAGTGATCTGACTTGTGCGATGGTGTTGGCGTGTTGATATAGGCACGGATACCGAGCTATCGTTGAACTCATTTTGACCACTGGAT
GCGATGTGGACGTAGTCGACAGTGTACGTACTTCTCTCGTTGGATTTTTATATTTCAAATGTAGATTCTTAGAGCTTGGATTGGCAGGTGGCTAGTAAGA
CTACTGCCTTAATTGAAGCTGCGCGTGCAGGGCACGCTGATGTCTGTGTAACCTTGCTACACCACGGAGCTAGTCCAAGACACCGTGACAGCTATGTAAG
CCGTTCGCGTTGTATAACTGTAGTAATTATCAAAAGACACTGATCGAAACAATATTCTATTGCGAATTATGCAGGGGG