Description :
From Genome Similarity Track
Location :
contig_47:307249- 313845
Transcript NameFunction/comments
g7882.t1myosin-like protein
g7883.t1hypothetical protein PHYSODRAFT_542020

Sequence
6596 bases(100 bases per row)
CTTGGAAAGTGCATCACGGCAGTCCATAGCCAGTTCCTTGCGCAGCGGCACGCTGTACACATCATTCACGGCACGCATGGTACGCGAACACAGCGCAGTC
TGAAGCGCTTCCCAGGTGACACCAAGCATCTGAGTGGCAGCATTGGCACCACTGTCGCCTTCGATAATGAGAGACTTCTCGTCATCCGATGGGTCGGACT
GCAGTTGCGCCTCACCAAGGTGGAGCACACCGGCAAGCACCTCGAATAGCGGCCGCTGATCATCGTAAGACAGACCCACAAGCTCCAGCGCCTCACGCGT
CTTCTTGAAGTGCTTCTCATCCGAGAGTCCTTCGATCTTCTGTGCTGTGTTGTCGCCAGTGTACACGTAGTGCTTTGCCGAGTCGAGGAGCAGTTCCGGC
GCAATGTCGGAGCTATCCAGCAGTTGGTAGAAGATGTGGTAGTTGCGCTCGGGCGCTTCGTGCTGAATGACACGAGTCTTCTCCAGCAGGTACGTGCGAC
ACTTGGCACCAACAAGCGTGCCGTTCTGGTCGAACTGCAGCTGTGTGAACTTGCCGAATCGACTGGAGTTGTCGTTACGCACAGTCTTCGCGTTACCGAA
GGACTCCAGCAGCGGGTTCACCTCGATAATCCTCTTGATGGTCGAGTTGTTCATACCACCAGCAATGGTAGCCAGGTGGTTCATGAGGATCTTGGTGGTC
TCCGTTTTACCAGCACCGGACTCACCACTCACCAGAATGGACTGGTTGATCTCGGAGCGGCGCATGTTGTCGTAGGCCGCCACCGACGTGGCGTACACGT
GCGGCGGAAGCTCCTCCTTGGGCTGGTTGAGGTATCTCAGGTGCTGCTCCTCGGCGTAGAGGTCTGGCAGCCACTTGTACGGGTTCACGGCGATGCAAAT
GTCGCCCGTGTAGGTGTACGGCAGCTCGCAGAGGAAACGCTTCTTGACATTGTACAGGATGGCGGCCTCGTGCAGGTAGTTGAGCGTGATCATGTCCTCA
ATACCCTCGGGCCCGACGTTCTCGTTCTGGTAGGGCAGCGACTCGAGCTGTTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGACAGCATGTCCACGCAAC
GCTCCTCGGTTTCGCCGTCGGGCAGCTCCACCTTGCACGTGATCTTGCGGATCTTGCCGTCGCCCGAGTTCTCGTCGCGAGCACCTCGGCTGCAAGCCAT
ACGTGCGTCTCGTCTGGCACGAAGCACTTGGCTCCCACCACCATCTGCAGGTCGCTCATGGTGTCGTCGAAGTCCCTTGGAGGCTCCCCCTTTAACTCAG
GCGGAGAGGTGCGCGGCTGACGGCCCAAAGCGGAATGCGGCAAGGGGGCCAACGCACCAAGGGGCAAGATACCGGTAAATGGAGCCATCTTGTCAACGAG
CAACTCGACTAACTTGCGATTTGTATGAGTTGCTCTGATCGGGCAACTAGAGGTTAGGGAACAGCGCAGCTGTGCGCCAACACCGGCTGGGATCGAGGTC
GCCCCGTGAGGATTTGTGCACGCTGTGCCGGCGAGTAAAGGCCCGAATCGAGCGTGCGCCACAGTAACCACGACCGCGTGTCTGCTCAGATGACAGTAAT
TGCGATGCGTGCTTCATGTGGTCGCGTATCCCAGCCAAAGCTTCTCAGGCGCGCGTGCAAGCATACCACCAACATGGCCTCAAAAAAAATTGCGCCGGTC
GTTTTCTGCTCGACATGATTTACCGCGAATGGTACCGGTTTTACTTATCTGTCACACGGCATACCTTGTTCAAAACCTCCAATAAATACTACGATGGGGT
CATCGCTTCAACTTGCCTCCTCATCGATTGAGACACATTGAGGACTCGAGCATTGGGCGCCAGGAGAGCCATACTCTTTTACTCATGAATGCGTCTCCAT
GTAGATTTCCAGCTGACCAGAGCGTCTAGGTCTCATTTGCTAATACGTGGCGTTCCTGCTGGCACTTGCGTGGGTTGCTCAGACCAGATCAATCGTCATT
TACTGCATGTGTCCGAACTAATACTTGCGGTGTTCCTTGTCGCAAAGTTCCGCGTACGGGTCCACATCCAAGGGATGGTCGTGCGGCGCCGATTTCGATA
TTGAGGTGGATGTGAATGTTTGCACATGTCCATTTAAACAAGAGCGCCGATTTCAGAAATAAGTGGTGGCAAATACACGTTCTCTAGCTTCCGGACTCTG
ATCAACATTGTATTGATCACGGGACGCCGTAGCCCGCGATCAAGAGAACTCGAGATGCCGGCGTCAATTGTGATCTTGTGAGCCTACCGAATGGCGAATG
GCTACATGTACAGAATTGTCGGTACACTGATGACGGCTTACCAGAGTGATGGTCAAAGAGCGCAATCAATGGCAATCACCGACGTCAGCGCCTCACATCC
AACATGGCGTCCAAGCTGCTGCGTCGTCCGCTGCTTGCTCGCTCCTCCTTGGCGCGCAGTTTCAGCGCCGCCACCACCGACCAGCAGCGTCGCGTGTGCG
TGGTGGGCTCGGGTCCTGCTGGCTTCTACGCCACGAAATACCTGCTCAAGGAGCACTCCGGCGCGCGCGTGGACATGCTGGAGGCGCTGCCCACGCCTTT
CGGTCTCGTGCGCTGGGGTGGCGCCCGACCACCCGGAGGTCAAGAGTGTCATGAACGACTTCGACAAGGTGGCGGCCGACGAGCGCTTCCGCTTCCTGGG
CAACGTGCGTGTGGGCGAGGACGTGACGCTCGCCGAGCTGCAGCAGCACTACCACGCCGTGGTGCTGGCCTACGGCGCCGCCGGGGACCGCGAGCTCGGC
GTCCAGGGGGAGCACCTGCATGGTGTCATGTCGGCGCGCTCGTTCGTCAACTGGTACAACGGCCACCCGGCCTTCCGCGACCTGCAGCTGGACCTGCAGC
ACGCGGAGACGGCGGTGGTCGTTGGCCAGGGCAACGTGGCCGTGGACTGCGCGCGCATTCTATCCAAGAACGCTGACGAGCTGGCGACGACGGACATCGC
CACGCACGCCGTGGAGGCGCTGCGCAACAGTGGCGTCAAGAAGGTCTTCCTGGTGGGGCGGCGCGGCAGTGCGCAGGCGGCGTTCACGATGAAGGAGATC
AGAGAGCTGACCAAGCTGGACGGCGTGGCATGTATCGTGGACCCGGAAGATCTGAAGCGCAGCATGACGCCCAACTCAGAACAGGAGATCAAGGAGCAGC
GCGCTCGAAAGCGCATGAGTGATTTGCTCGGCAAGGCGGCGGAGCGATTCGCCGGCACCATCGACGCTGAACGCGTTGTGCAGATCAAGTTCTTGAGTTC
GCCTGCAGAGATTTTGGCGGATGAGAAGGACCCGACTCGAGTGGGAGCGATTCGCGTGGAGAAGACGAAGCTGGAGGGCGAGCCGAACCAGCAGCGTGCG
GTTGGGACTGGGGAGTTTGAGGACATTCCGTGCAACCTCGTGCTTCGCAGTATCGGCTACAAGTCGCTGCCCATCGAGGTCAACGTACCCTTCGATGACC
GACGCCATGTAGTCTCGAATGAGCAAGGACGTGTTGTCGCAACGTCCGTTAGCGGTGAAAAGCAGCCCGTTGTGGGCCTGTACTGCACTGGTTGGGTGAA
GCGTGGCCCCTCTGGTATTATCGGCACCAACATTTTGGACGCACGGGAGACAGTAAGCTGCATCGTCGAAGATTTTGCAGCAGGCAACTTTCTTCACAGC
GATAAAAGCTATGGCGAGGACTTGGGTGGATTGGAGACTGTGGAGAAGCTCATCAAAAAGCGTAACCCAGAGAAGCAGCTAGTTAGGTGGGCTGACTACG
AGCGTCTCAGTGCCGAGGAAAGCCGCCGCGGCGAACTTCTCGGAAAGCCGCGTGAAAAGGTCACGTCTGTGGCGGAGATGCTGTCGATTGCAAAAAGTAT
GTGACTAGCTGCTAAGAAAACCCAAAGATGATCTGCGGCAAATACTGAGTAGCGGTGCGCAAACACACCTAGAGAATCGATTTTTATCGATGGTAAAACG
TCACTTCTTGGAGCCATTGCGCTCTTTTTGGCGAGTAAGTGCAGCATTCGAGGCTTTCAGTGCGCGAGTCTTCTTGCGCTGCAATACCACCACAAGTCAA
TTGAGATTGAACCCGTCAGCTCGCGTCCTCATGAGACTGTAAGCAAGGCGTACCTCTTCTTCTAGCAGCCTCATCAGACGCCTGCACTCCGCTGCACCTT
CAACCGTGTCGTCCTCGTCCTCGTACTGATTCATCACCCTAGATCGAGCCTGAGTTGCGCCATGTCGCTCTTCATGTGCGTCTTGTTCATTTGCGTCGAA
AGCAAAGGTGTTAATGAAAGGCTGGTTCACTCGATCACGCAGAGTTGCCGCGTAGGTTGGTTTAGTTCTTCGAACGGGGGCGGAAACTGGCCGTGATAGT
TTGCTTGCCGAAGATGCCAAAGTGGCAGAACGTGGGTGTTGCAAAGGAAGTCGTGCTGCTGCTGTCGCCATCTATTCGCACGACGATGCATTCGGTTAAA
CGTGCTGCTAACATCGGCAACGATGCAAAACATTCTGCTCGTACGATGGCTTTCACATGCCGCAGCTTCGCAGGATCCGCCAGAATATTTGTTGGCAATG
AAAAGGCTCTGGGATAGCATCACCGAGGTTAGCTGCGCCGTACAGCAGTATCATAAGGAAGATAAACTTGAGTGGCGTTCGCCGCTGCTCGTACCGCTGG
CTTGTGTCCACAGCGCTTATGAGCCGCCCAACATACGTGTACATCTCCAAGCAGTCCTCGCGGATATTCTACGATAGAACAGTGAGGCATCAGAGGATGG
TTTTAGCAAGCTACAGCACCAACACTTTACGTACATCCATAGTATCAGTAGTGGACTGCTGTAGCTGTGATAATTTGCTGTTTGTAGTGTTGAGCTCCTC
TGTTTTGCTTTTCAAAGACTGCTCATACTGTTGAGTGCACAACATTTGTCAACAACTTCTGATGCAACGCAGCTTCTGTCCAACGTACCTGCTGGCGAAT
GAGAGCGATTTCATTCTCTTTCAACTTTTGCAACGCAGCTACTCGTTGGCGTAATTTCTGAGTGAGAAGGGCATGACATATATATTCGTGAGTTGACCGA
GAGCATGGAGCAACGCAAACAAAGCCTGGCCAACCTGGTCGAACTGCTTTTCTGAGGAATCGGAAGTATCCACGTGTGGATTGATGTTTGAGGCTTGATG
CTGATGATAGGGAAGCTCGTTATCCACGCTGGCGCGCATCTGGTTGTTTCGGCTGAGGAGCTCCATCATTTCTGCTCGGTGCCGGGCGGCCTCTGACGCC
AAAGCGCGCTCATACTCACACGACTTTTGCTTCAAACAACTTTCTAATGTAGCAATCCTCCGCTTCTGCTCGTTGACGACACGTCGTGCATTCTCTTTGT
CTTTCTTTGCTTCAGTCTGGAGATAGTAAGATTACGGTCGTCAGCGAATTGGAGATCAAGTTGCCGAAGATAGCCATTCCTCAACTCACCACGACCACAG
TGAAATTACTCTTTGCATTGGTGTACTTCTGTCGTAATCGATCCCGATCGGTCCTAGCATTCTCTGCTGTTGCGTGATTCAAAAGTAAAATGACGGGTGT
AAAGATTCATAAAATTTGTTCTACGATACCCAAACAACTCACCGTTGGTTCTCAATAAACCTTGGACGTGCCCTGCAGGCCCAGTGTGCCTGTTCTTAAG
ACATGAGCTTGAGGTTACTGTACGGTCCCCTTGGTCTTCATCCGAAAACACTGACTTCAGCACGAGTCCGTCCTACGTTCACACACACATAGCAGAACTG
CTGGGTCAAACCAAATATTCAACCAGTTAGATATGTGCGACCTACTGCAAATTTGATTTCGCCGTTTTCCGAGATCTCTTCAGCCTGGAAGCCGAGTTCG
TTCAGTGTGGAAACAAACTTATTGTTGTATTCCGTGCGCAAACCCTCAAGCTGACGGCGCAAGACGCTCAGCTCTTCTTGAAGCTTACGGATACGCCGAT
CCTTGTCCACAATTGTACCATTTATATGATTTACACGGGGCTACGCAAATGCAACCACCAGGTTAGTCGCAGCAAATGAAGAAGTACGTTTTGCATTTAC
TTACCTGGTTCTGCACGGAACGGCACCGGTTGGCAAACTGGAGGGTTCCCAGGCATTCTTCATAGTGCTCCTTCATCGGATGGATAGTTGCAATAAGTGT
GGTAAAACAATTTCCTCCTGCAGCCAAAAGTACAAAGCAAAGGCAAGTTAATTAAGCAATGCAATCAAGGAGTAAATTTGCTTCATGCACGAACCGATGC
TGTTCTGTAGAAGTCGCGTTAGTTTCGAGTCCCGATAGGGGATGTAGTTATAGCCGCTCTCTGGATCTAGTGACATCACAACTTTGCCCACGGCACTCAA
GCTCGAGTTAATATGCAATGCCTCCTTGAGGCGCTGGCCATCCGACTCGCTCTTTTTCAGGCGCTCAGACCTAGCACCACAAGAGCACCGATGTCAGAAA
CGCAAACAGTTGCTGGGGGCTGCTTCAAAAGGACAAGTATGCACCCTGCTAGATCCACCATGTTGAGCATTCCGTATATCACTTCCTCGGTGTCTC