Description :
From Genome Similarity Track
Location :
contig_24:30724- 32122
Transcript NameFunction/comments
g5327.t1hypothetical protein

Sequence
1398 bases(100 bases per row)
CAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGTCCAATGAAGCGCGGAACAAGCAAGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCT
AGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGTGTTCAGCTTCTGTCGATCGACAGAAG
CTGCTATTGCGTCCTGGACAAACCGAATTACGGCTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAGCCCCTGGTTCAGTTCGTGCTCCTTGTT
CGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTTGCCATGACTGCGCGCAGTACGT
GCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCG
CACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGC
CATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGC
GGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGT
CGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTT
GCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGAC
GGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACT
GGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAG
CTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGG
GCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAATGCTTCGCATCCGCATCATGTGCGTATGCGGCC