Description :
From Genome Similarity Track
Location :
Scaffold_283:30721- 33589
Transcript NameFunction/comments
Phymu_g8048hypothetical protein PHYSODRAFT_300538

Sequence
2868 bases(100 bases per row)
GGTGACGCCACGCGAAAGTCGCGGCGCTCCGACGGCTTCTCCCGTCGCCGACGGcgctccaacagctccgaTAATGCTACAACACGTTCCCAAGACGCCA
ACGATGGATCTGACGTTGAGATCATCCACGACTTCCACTCCAAACGGGAGATAGAAGCGGAGCAAGACGAGGCCAAACTCACCCCAGAAGAGCGCGAGCG
ATTGCGCGACCGTGAGGAGCGTGACGCCTTCGCTGAGCGTTTGCGTCAGCGCGATGAGGATCGCACTAAACGTAAGCGTAAggccgaggagctggaggct
tcTGAGGCCCCGGGAGGTCTCACGAGCGACGAGATCAAGCAACTGGCCAAAAGGGGGACAGTTGACGACGGACAGAGCGCACTTAATGACAAGCTACAGA
GGCTGCGAGAGCTCAGTAGACAGGAATATCTTAAAAAGagggaggagaaggagctggagttgctggagttCCAGTTAAAGGACGAGGACGTCCTGTTTAA
CGAGTCCAAGaggtcgaagaaggagcaggagcagctggaacTCAATAAGAGGATCCTAGAGACAGCCAAGGCAAGAtccaagaaggaagaagtggacgGG
TATCAGATTCCTGATTCCtatgaagaagtggacgatgaaggcaACAGAATCAGGAAGAGAGAGGACCTTTTGACGGACAGAtacgaggaggaagaagtgt
TCCATACTGAGCAGGAAGTATGGGAAGACACGCAGGTGAAGATGGCTACCAGTCGGTTTGGAGCCAAggacaagcacaagaaagtggaggaggaagacga
gttTGTGTTCGACGACCAGATTGATTTCATCTCCCAGCAAATGCTCTCGGGGCATCATGTGAGTGAGGAGGATGTCaaagaagccaagaagaagatggag
gaggccaaACATCTGAGTATCCAGGAAGGAAGGAAGCAATTACCGGTTTATCCATACCGGGAATCTCTTCTGGAAGCGATTCGAAATTATCCTGTCATTA
TCATTGAAGGAGAGACTGGATCaggcaagacgacgcagatCCCGCAGTTTCTCCACGAGGTTGGATACTCGGAGCTGGGCATTATTGGCTGTACACAGCC
TCGACGTGTTGCCGCTATGAGTGTGGCTGCTCGTGTCGCGCAGGAGATGGATGTCAAACTGGGGAATGAAGTTGGATACTCCATTCGTTTCGAGGATTGT
ACCAGCGACAAGACGGTGATCAAGTACATGACCGATGGTATGCTGCTGCGTGAGTTCCTGACGGAGCCTGATCTGAAGACTTACAGCGTCATGATCATCG
ACGAGGCTCACGAACGCACCCTTAGTACGGATATCTTGTTTGGCCTTATCAAGGATATCTCGCGCTTCCGTGACGACATCAAGATTATTGTGGCCAGTGC
GACGCTAGATGCGACCAAGTTTAGTGCTTATTTTGACGATGCTCCGATTTTCAAGATTCCTGGCCGCATGTTTCCTGTGGACATTCTGTACACAAAGGCT
CCCGAGGCTGACTACCTGGATGCTGCCATCGTGACTGTACTGCAGATTCACATCACCCAGCCGCTTGGAGACATTCTCGTATTCTTTACAGGCCAAGAGG
AaattgaagctgctgaagagattTTGCTGCAACGTACACGAGGCCTTGGCTCTCGGATACGCGAATTACTTATACGACCGATTTACGCTACGCTGCCTTC
TGAACGCCAAGCGCAAGTGTTTGAGCCAACCCCTGAGGGGGCTCGCAAGGTTGTACTGAGTACGAATATCGCTGAGACGTCGCTGACCATCGCTGGCATT
TGCTATGTGATCGACACGGGCTTTTGCAAGCAGACCAATTACAATGCGCAGACCGGAATGGAGTCCCTGTTAGTCGCTCCAGTCTCCCAGGCTATGGCCA
ACCAGCGTGCAGGTCGAGCAGGCCGTACTGCCCCTGGTAAGTGTTTCCGTCTGTATACGGCATGGTCGTATAAGAACGAGCTAGACGAGAACACCGTGCC
GGAAATCCAACGCACCAATCTCGCCAGtgtggtgctgctcatgaAATCGCTAGGAATCAACGATCTGCTTCACTTCGACTTCATGGACCCTCCGCCAGAA
AAGGCACTGATCCGCTCGCTTGAACAGCTTTACGCGCTTGGCGCTTTGAATGGCTTAGGCGAACTGACGAAGCTGGGGCGTCGCATGGCAGAGTTCCCGC
TTGACCCGATGATGTCCAAGGCGCTGCTTGCTTCGGAGAAATTCGGCTGCGTTGAAGAAGTGATGACGATCTGCGCTATGCTGAGTGTGAACAACTCGAT
TTTCTACCGACCGAAGGATAAAGCGGTCCACGCTGATAATGCGCGGCTCAACTTCGCAcgcggtggaggcggcgacCACATTACGTTGATGAACGTGTAC
AATCAGTGGGTCGAGACGAACTACTCGACGCAGTGGACGTACGAGAATTTCGTGATCATGCGGTCGTTGAAAACGGCACGGGATGTTCGTGAACAGCTTG
AAGGACTGTGCGATcgcgtggagctggagcgcacAAGTAATCGCAGCGACCATGAGCCGATTCGCAAGGCCGTTTGTGCCGGCTACTTCTACAACACCGC
CAAGTTAGACAACTCAGGCCACTACAagaccgtgaagaaggcgcagtCCGTGCATATCCATCCAAGCTCGTGCCTcatcaagctggaggaagttCCGCGT
TGGGTTGTGTATCACGAACTGGCATTTACTACGAAGGAGTACATGCGCAATGTGATCCCCATTAAGGCCGACTGGTTGACGGAACTCGCGCCGCACTATT
ACAAAAACAAGGAAGTCGAGGACGCCCGTGCCAAGAAGATGCCCAAAGGCGTGGGGCGCGCAGGTTAA