Description :
From Genome Similarity Track
Location :
Scaffold_70:307207- 313292
Transcript NameFunction/comments
Physo_139136hypothetical protein
Physo_139137hypothetical protein
Physo_109187oligopeptidase A

Sequence
6085 bases(100 bases per row)
GGGCGATGATAGTGTCTTCCTGGGTCTTGATGCAGTGGCCGGCAGTCAGAATGTACTGCGGGGCGATCAGCGTGCCGCCGCAGAAAGTCGTGTCCACCTG
CTCGAAGCGCAGACTCGTGGCGTACGGGTAGTCGTCGATGTTGGCCTCCGAGCCGCCGTAGATGCGGTTCTCCTCGTTGGCAGTGAGCCCCGTGCTCTCC
ATGTCATTGGTACTTGGGGTGGTTGTCTTCATGGACTCCGAGAACGAGTAGCCGTGGACCACCGATGAGACTGCCGAGGCCAGCACAAGAATCTGCGGGA
CCTTCATGCTCACTCGGTACAGTGGGTCGGTGCACTCGGTATCACCAAGTGATTAATTAACACGTCGCTTAGCAGGTCCGTCGAACAGCTCAAAGCTTAG
ACGGAGAAAGCCAAAGTGGCCGTCTCGCAAAGGCGCGACCAGGGGGGGAGACGATGGTTATGCTGGACGCTCTCCACCTCCACCACCATCTCAACGCGCT
ATCCGGTCTGGGCAGTCAGCTCGATTAGTACATGAAATACCCCGATCAACGGTGGCGCTAGACCCATAGAGCGATCGGATTCGAGGAAACGGCCGGATGG
TGCCAGCAACTGTACTGAGATATGGAGCAGCAGGCCATTACTCCACCAACTGGCGCTGCCCAGCCCAATGCTACGAAAACAGCGGTTGCTTGCCGCGTGC
GACTCGCATCAGGCTGCTCCCGGCCATGCGGGATGTGAAGCGATCATTTCGGCTCATGTTGGCGACAGCTTCAACGCCTACACAAGACAACCGCAACGAT
ACGTACAGAGCTGAAGGTACAACTTACATGTAGCGCCGAACACATCTATTGACCCACAGCACACACTTTGAGCGCTTACGATACGACCGCAAAAATCAAA
TCTCCTTCCTCATCTTCTGCGCTGGACGTCGACACCTCTTCATCACTTTGATCAAAACTGTGAAGCGCAGTCCTTGCCGCTGTCGATCTTCTTGCCTGAG
GCGGGCGTCGGATCATAGGTTGGCATGCTCTGCTCGGCCGAATCCGTAGCGTTCTCACTGTGATCCGCTGAGTTTGGTGAAGACTCCGACTGATCCGCTT
GATCCGTGTTAGGACTCTCCGTCTCTGGCTCCTCGGTGGATGGAGCTACCGTGTCAGGCGGCACCGTCGTTGGAGCTGACGTCGGTGCCGGAGTCGGTGA
GGGCGTCGGGGCTTCAGTCTTTGGTGCCTCGGTGATAGGCACAGGTGTCGGGGTCTCAGTCGCAGGGGTTTCTGTTGCAGAGACATCGACATTCGACGAA
TCTGCGCCTCGACTCTCACCTGCCGAGCTCGGTGCACTTGGGGTGAAGCTGCTGCCCGAACCGCCACTAACGATGCTGTTGATGTAGTCGAGCACGTACG
CGACGCGAGTGTACACGCCAGCATTGACGCCGCATTTGCCACCCCAGCTAACAATGCCAACCAGAACGTCGTTCGCAATGAGAGGACCCCCAGAATCGCC
GTTGCACGTGTCCTTGCCGTCGCCGTTACCCGCACACATCATTCCTTCGGTGATTCGCTTGCCGTACTCCTTGTTGCACTCGGCGTTTGAAATTATGTTC
ACATTCACTTCCTCCATCTTCACGCTTTGCGATCCGTTTTCGGTGAGGCCCCATCCTCTGACTGTCGCCACAGTGCCGACCGTGTTGTCCGATCCGTCAG
GCGCAGCCAACCCGACCGTCGTTGTAGAGACCTTCTTCTCAAGCTTGAGAAGACCCACATCGTACAAATGCGCGGACTTGTTGTACTTGGGGTGGCGGTA
GCCCTGGATCACCTTCACCTGCTGCCCGTCACTCGATCCCGAAGCAAATGCAGTTCCAATCGACGCGTAAATGGTAGCTCGGTCGGTCTTGACGCAGTGA
GCAGCCGTAACCACGTACTGCGAGGCAATAAGCGCGCCGCCGCAGTAAGTGCTGCCGCCAGCGTCGTTCTGGCGCAAACTCACAACAAACGGGTACTTGG
ACGCGTCCGCCTCCGATCCACCAAAGATGCGGTCCTCCTCGTTGACTGTTAGCCCCGTGCTGTCCTCCACTTTCGACGCGTCAGAGGTCTCTGAAAACGC
GTACCCGTGCGTTAGGGTGACCGCTAGCGCGGATGCAAGTACACCAGCGCGAACAACAGCAGCGAACGTCATTGAGCAGTGTTCGTGAGTCCTCTGCTGG
TGAAATCCGCTCTGCGCTGGGAAATGCTAAATCATGCGGGGCTAAGTAGCTGTAGAGGGAGAGAAGGATCCGGTGACGGACGATTGCCACCATACACTCA
ACAGCTTTTCCAGGCCCGCCACTGAAATGCCTTGGCAAAGTATCGGACAAGGTCGTGTGAGGTAGGGCGCGCTCCAGCTGGCACACTCGTGGCTCCGACC
AGAACCGTTACTCAAGCTCCGCCTCTGCCCAGTATTTACTTGGAGCTGCGTACATTTTCAATTCTGGACACCAAGCACAGCCACACGCTCACGCAAGTCG
CCAGTCGCAGGTGGCGCCGTCCATCGTCCCTAGCGAAAAGGCCCTGCCAGCTAAAGCGGGACTCACAACGGACAGAAATCCTTGATCAAGAGGTGCAAAG
CGGCCCAGCTGGCAGCTTTTGACAGGTTCCGTAGCAGCAGGCGATGCCAGTCAAGTCTCTCCGTTCCGAGCCAAACACAGCAGTCTCCATGCAATCCGTC
AGGTGGCCGTCACCAAGGACCCAGCAATTGAGCTCTTCAACGTCAGTTTGCACCAATAGTATGGTACAATGTTATAGCGGTTAGGGCTCATATCCATCAC
GGGCATTTGAGGCTGTCAGTCAATACGTAAGCTTACTGTACCATCGCCGCCGTCCACCATGCTGCTCCGCTGCGTGCGTCCGCTGCGCGCGGCGTCATTG
TCGTCGGCCGCCGCCTCTCGCCGCTCCGCGCTCTTCTGGCGCAGCTTCGCCTCTGCGTCCGCCAACTCGCTGGAAGTCTGCGTGCGCGAGCGCCAGCTGC
CGCCCTTCGAGCGTCTGCAGCTGGCGGAGATCGAGCCGGCGGTTACTACGGCCGCCGCTGACTTCACGCACGACCTGCGCGAGCTGGAGAAGAAGCTGCA
GAGCGCGGGCAAGAGCGTGCAGCTCGCTGATGTCGTGGACCCACTGGAGGTGCAGGGCGACGCGCTGGGCCGCATGTGGGGCATCGTGGGCCACCTCATG
AGTGTGCGCAACTCGGAGGAGCTGCGCGCCGTGCACGACAAGCTGCAGCAGCTGGTGATCGAGACGGTCACCGAGGCCTCGCAGAGCAAGACGCTCTACG
ACGCGTTCCTCGCGGTGCGTGAGAGCGACGAGTGGAGCAAGCTCGAGCTGGCGCAGCAGCGCATTATCGAGCTCAGTCTCAGAAGCGCCACGCTCAGCGG
AGTCGGACTGCAGGGCGAGGACAAGGAGAAGTTCAACAAGCTCAAGCTGCGTGCTGCCGAGCTGGTAAGGAAAAGCTGCAGTGTATGTGCGATTGGTTGG
TGACTTACCTTGTGATGGGTTCCTAATGTCTGTAGAGCACAAAGTTCTCCTCCAATCTGCTGGACGCTACGAAGGTGTACTCCATTACAGTGACTGACAA
GAATGAGCTGGAAGGACTACCGCCGTCGCTGCTGCAGATGTTTGCGCAGAGCGCTCGTGACGACGGCCACTCGGAGGCCACCCCCGAGAATGGGCCTTGG
CGAGTGACGCTGGACCCCCCTTCGTACGTGCAGTTCATGAAGTACTCGGCGAACCGATCGCTGCGTGAAACGTTGTACCGCGCATACGCGACCCGCGCGA
GCGGAGAGTCTTTCGACAACGAGGGTATCATCGTCGAGCTGCTGGAGATCCGCCAGCAGATTGCGAAGCTGCTGGGATTCAACTCTTACGCTGAGGTCAG
TATCTCGAAGAAGATGGCGCCGAGCGTGGAGGAGGTCGAGAAGATGCACAGTGATCTGCGCGAAAAGTGCGTTGAGATCGCTCACGAGGAGGTGAAGACT
GTGGCTGAGTACGCGAAGGAGCACGGACAGACGGAGCTCCTCGCGCCCTGGGACCTCGGCTACTGGTGCGTGCATTGTGATTGCCTGTACAGGGCTTTAC
CGTCTGTGCTAATCTCTATCGTTTGCGTGCTTACGAACAGGTCGGAGAAGCTGAAAGCAGAAAAGTACCTGTTCACTGATGAAGAGATCAAGCCGTACTT
CCCGCTCGAGCGCGTACGTTCACGATACTCCCCGTTCTTCATTTGAGATGACTCATAGTCGATTGATTGTTGCTGATACCCAGGTGCTCGACGGTCTCTT
TTCGCTCACGTCGCGGTTGTTCGGCGTGACCATCGAGGCTGCGGACGGCCAGGCCGAGGTGTGGAACTCGGATGTGCGCTTCTTCAACGTGCGCAGCACC
GACAAGGAGGTGATCGCTCAGTTCTTCCTGGACCCGTACTCGCGCCCGAAGGAGAAGAACGGCGGCGCTTGGATGAACACGTGTGTGGACCGCAGCCGCC
TGCTTGGCCCCAAGGAGAAGGGTGGCAAGCGTATTCCGGTCGCCTACATCATCTGCAACCAGTCGCCGCCCGTGGGCGAGACGCCGAGCCTCATGACGTT
CCGCGAGGTGGAGACGATCTTCCACGAGTTCGGCCACGGGCTGCAGCACATGCTCACGCAGATGGAGTACGGTGACGTGGCGGGCATCAACGGCATCGAA
TGGGACGCCGTCGAGATCCCGTCGCAGATGATGGAGAACTTCTGCTACGACAAAAGTCCGTTAAATACCGCACTACGATACCTTGTGGACATACGAACTA
ACCTATCTATCCTGCTTGCTTCTTTCATCCCGACAGACACGATCGCAGCTATCAGCGGACACTACAAGACCGGGGAGCCGCTGCCCGACGAGTTGTTCGA
GAAGCTCAAGGCGGCGCGCAACTACATGGTGGCCACGGGCATGCTGCGTCAGCTGGGCTTCGGCGCGCTGGACATGTACCTGCACTCGCACTACTCGCCG
GCGCAGGAGTCGCTGTTCGCAGCGCAGCAGCGCCTGCTGGGCGAGTACGCCGTGCTGAGTCCGCTGGAGGAGGACAGGTTCCTGTGCTCGTTCGCGCACA
TCTTCGCGGGAGGCTACGCTGCCGGCTACTACAGGTACGCAGTCAACTGTATGTGATTGAATTGAATTGACGCGTGGACACTCGACTGACTTGTTGTGCG
CAACCTGTGGACACAGCTATAAGTGGGCCGAGATCTTGTCGTGCGACGCCTACGGCGCCTTCGAGGAGGCGGCCAAGGAGAGCCCCGAGGCCGCGGCGCG
CGTGGGCCGTCGGTTCCGCGACACGATCCTGGCGCGCGGCGGCGGTCAGCACCCGGAGCAGGTCTTCGAGGCCTTCCGCGGCCGCAAGCCGTCCGTGGTG
CCGCTGCTCACGCAGTACGGCATGGCGGACAAGTAGTTGCAGTTGCAGGCAACTTCAACATGGCAGTAAAAAGTATCCATCACGATCATGGCATAGAAAT
GGGTTAAGTGCTGCTTGGCGGACGGCCGCGGATGAGTGGTGCCTGTGTGTGTTAAACGGGAGCAGGCGATGGCGGGGCTTTGAAGGTGGCTTCGCTCCGT
GTATGCAAAGCGCAAGCCCGCGCCTCGGTTGCCAGCGCTGCTGGTCATGCTGGCGCGAAAAGAACACGGGCTCAGATACGCGGCGCATCCCCCCAATGCA
ACTTCAACACCACGCAGCATTAAGTCTCGGAGGTTCTTCAACACAGAACCTGCATGCGAAAAGTAGCTGAGAATCATGTAAAATTGCACGTTATCGAATG
GAATTCACAAAAAATGCGTCGCAGCAATCGATCCTACAGCCGAGGAAACGGACAGCACGACACCACCAACGTCTTGCAAGGCAAAAAACTGCCTTGTTTG
AGCTGTAAGGACGCTGTTACAGTCGCTTGGTTGCAGGCACCAACGTAGCGGGGGGAGGAGTGCAATCACAGCGATTACTTGAGACGCGTGGCAACATTTC
GCACACCGACCTCCTCTTCCCCCTTGCGCTTGCCAGCAGCAAGTACTGCACTGCGAGCGCGCGTCTCCTCGTCGTGGGCAACACG