Description :
From Genome Similarity Track
Location :
Scaffold_297:30719- 32527
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_297-fgenesh-gene-0.62-isopropylmalate synthase

Sequence
1808 bases(100 bases per row)
CAGCACGCTCCTTGGCCGCTACTAAGCGGTTCACGGCGTTCACGTACGCGGTGGCGGACGCGACCAGGATGTCCGTGTTCGCGCCGTGGCCGACGTACTG
GCGATTCCGCAGCACGCCCGTCTGTGGGTTCACGAGGTCGCCCGTGGACGACGACTCCGAGTCGCCCTTGTTGCTGTTGCTCGCGGCCGCAGCCCCTTCG
TCCTTCTCTTCCTGCACGCGCACGGTCACTTCACCAAGCGCGTACGTGCCGTCGGTGATCGAGTTCACCGAGTATTCGTTCAGCTTCAGGTGCGGCATCT
GTGTCGCGCGCTTGATCGCCACGTAGATCGCGTCCACAGGTCCAGTGCCCATCGCGGCCTCGCTCACTTCCTGGCCGTCCTTGTACGCCAGCGTGACAGT
TGCAGTCGGCTTGACGCGGTTACCGGCCGTCACGTGCACGGACTGCAGCGTCCAGAACGTCTCAGGCTTGTAGAGCTCGTCTGAGACGATCGCCTCAATG
TCGGCGTCCGTCACCGTCTTCTTCTCGTCCGCGAGCACCTTGAACTTGTCGACGTAGTAATCCAACTGCTTAGGCGTCAGGTCCGTGTAGCCGAGCTGCT
GCAGGCGCTTGCTATACGCGTGGCGACCCGAGTGCTTGCCCAATACCATCTTATTCTCGCTCAGACCGACCGACTCCGGGAGCATGATTTCGTATGTGGC
CTGGTGCTTCAGCACGCCGTCCTGGTGGATGCCCGACTCGTGCGCAAACGCGTTCGCGCCGACGATCGCCTTGTTCGGCTGGATCGTCATGCCCGTGTAG
TGGCTCACCATGCGGCTGCAACGCGTGATGTGCGTCGAGTCCACTGTCGAGTACACTGGGTAATGCTGTGGACGGGTCTTCAGCGTCATGATGATCTCTT
CTAGCGCAGTGTTGCCGGCGCGCTCGCCGATGCCGTTGATGGTCACTTCCGCCTGACGCGCGCCGCCCACGATGCCGGCCAGCGTGTTGGCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGCCCCAGGTCATTGTGGCAGTGGGTGGAGAAGATCGCCTTCTCGCTGCCCTCGGTGTTCTCAATCAGGTAGCGGATCAGTG
AGCCGTACTCGTCTGGCACCGTGTAGCCGACCGTGTCGGGGATGTTCAACGTGGTGGCGCCAGCCTTGATCACCTCCGCGAGCACTTCACAGAGGAAATC
CGGATCGCTTCGACCGGCATCTTCCGGCGAGAACTCGACGTCCGGTGTCAGACTCGCGGCGAACGACACGGCCTCCACGGAGCGGCGGATGCACTCGTCG
CGCGACATCTTGAGTTTGTACTTCAAATGGATGTCGGACGTCGCGAGGAACGTGTGGATGCGATGGCTTGGAGCGTGCTTGACGGCGTCGAAGCAGCGCT
GGATGTCCTTCTCGGTGGCGCGCGCGAGACCTGCGATAGTCATCGGCTTGCCGGACTTGCGGCCGGTCACGAGCGGACCGATCTCCTGCGCGATCGCCGC
GACGGCTTCGAAATCGCCCGGGGACGAGATGGGGAATCCGGCTTCGCAGACGTCGACGCCCAAGAGGCTGAGAGCGCGCGCGATGTCGAGCTTCTCGCGG
AAGTTGAGGGTCGCGCCGGGTGACTGCTCGCCGTCGCGCAGCGTCGTGTCGAAGAGGATGAGGCGTTCCTTGCCCTCGGTGGCGTCGGTGGCGGCCGTGG
AGAACGCGGCGCGGGAGGAGGAGGCGCGCGAAGCCGTGTGCTGCGCGCGGGCGGCGGCGGCGGCACGGGCTCGTCGGACGGCGCTGAGCATCATGGTGAG
TGTACGAC