Description :
From Genome Similarity Track
Location :
Scaffold_487:3071- 6293
Sequence
3222 bases(100 bases per row)
AACCCTTACCAGAAATGTTTTGGTTACCATCTTCATGGAGGGACTTCGTACGGGCGTGGCTAGAAAACGAAAGCATTCCGGGTATACCCCACCTCCTTTG
AGGCGGCTGCGGATATTATGCTAAACGCTGAGTTTAACCTTAAGGCAGCCCGTATTGGCACCCATGGGTACAACCTAAACTCGGCGAACTCAGTTCATTC
AATAGGCCGGAGCCTATGGACCTCAGTCTCGCCGAGACGGACCAAGAAGCAGAGCTTCGAGCTGTAGAACAGCATTGAAACATTCGACGATATTTCACGT
GCGGAAGCACAAAGCATTTACGACCTAATTGCCTTTTAAGCAGGGCACGCCTGGCTACTTCAGGCGGAACTCCCACCACTAACCAGAATTCTGGTACGGT
GCGGGAAAACGTAGACTCCCAGTAGGCGCGAGGCTCCCTGCTGGGAAAGAACTAGGTTTTGTTGAGCCTCTAGGAGGTAGAGGAAAGCGGAATTTATCCC
GAAGGAGCCCCGTGCACTCTACACGGGACGTGAATTCAAGCCAGGCTTGTTGGTCGCAAAGGCGACTGTTAGGGGCTTTGACAAACCCAGGTCGATTTTG
ATCGACTCCGATCATCCGGTAATTAAGTCAGACGCTGTTACCTTGAAGGATATCCATGATATGTTGCGGCGCTAAAAGCGCACAAGGTGTTATGATCACT
GTTCGCTTGGCGACAGGAACGCTAGTCACCGCACCCAAAGTTCCTGTGAACTTGGGTGTGAATTTTTTCGATTTTGAATAGTATCGAACGCTCTTTGGTC
CTTGATTTGGACTCGAGATATGATCTCATTATTGGTATGGCTTGGATTGGATTGGCTTGAGCGCCATGAGCCATGGATCGACTGGATGTCGAAAACATTA
GGCGCCACGCGCACTGCCCCTACTGGAGCTTTGGAGAGTCATGAAACTACCTCTGCTAGGAATCAGAAGCGTTATTGGCGCGAGCCACTGGCTGAAAATT
TCAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAGTATAGAGCAAAGCTCGATATGTGATAGTGAAGCGGCACG
TACTCCGCTAAGTGATAGTCGTTGTGAGAGCAACGTACTGAATGCTGAAAGCATTGTTGACCAAGCGTCAAGTCATCGAGGGTTGCAACCATCAGATGAG
CGTGGAGTGGCACGCAAGTAACCACTGAGTGACGTTGGGTGTGATAGGGACGCGCTGAATGTCAATATTAACGTTGTTGGTGAAATACCAAGGCATCCCG
ATCTCGGCTCAGCGGATGCACGTGAAGTGACTTGTATTCCACGTGATGAAGACGTCATGTCCAATGACTCGTCATCGGATGTCAATAGTGATGTCAGCTT
TAGTTTAAAGCAAATTACGTTCGATGATGGTATCGATCAGAGAGATTCGAATTACACATCGTGTGCTATATCACAAAGTGATGATGAATATCAGCTGTAT
ACACTCGTCAACGGAGTGACTGGTGCTTGTGGTGGTACAATTAGCCTTGAGGCTATACCCTCGTTAAGATCGCTTTCAGAACTCGAAAAGTTGTCGGTCG
ATGAGTTTGATCACTCACTTAAGCATTGTGACCTTTAGAGTTGGCGGTCATTCGACCCGACATCATAGAGTTGAACTCTTCTTTACTTTTGGATGAAGCC
GTTCTGGAGGACACAAAAGCAGTACTCAGTGCGCGTAGTGGGTCATCAATATTGAAAGACTCTCATGATCAACTTTTATTCTTTAGTCAAAAAATTTCAA
GATGTGGTGTGCTACGATCCACCCTCTGTTCTCCCTCCAGATAGAGGTGTCCGTCATAAAAGTGACTTAGTTCCTGGGACGAAATACTGTGTCACACGAC
AGTGGCCCTTGACTAAGAGCAATGTGATGTCATCGATGACTTCTTCCGTGCTAAGCGCGAGGTAGGAGTGGTACGTGAGAGTAAATCTCCACATTCGACA
CCAATATTTTTGTCAAAAAGCCGAACGGCAAGTGGCGTATTGTGCATGCTTATACAAGCTTAATGCGGCTACTTTTCCGGCACAGACATCCATGCTTCGA
AAGGATGTTCATCAAAACAACATGTTTTACTATGTATAGAGGATTCGACTGGTGATAGATATTATCAATTGCTCATGTGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN