Description :
From Genome Similarity Track
Location :
Scaffold_55:307083- 309134
Sequence
2051 bases(100 bases per row)
CCACAGTACTGGGTCTCAAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGACCAGCTGCCGATACCAGTTCCTGACTGGCCCCGCTAGCA
GACCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTG
ATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAAATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACT
GCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTT
CGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTCTCGCTGCAGGGTGCCCGAGGA
AGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTG
CCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCC
TCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGTTTCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGGTTCGTAGTT
CGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTC
GCGGATACTATGAGATCCAGGGTCTAGCTCGAAGATAATCCTCTGCGTCGAACAACCCCAGCTACGATGCCCTGACTCCCGTAAGCAAACGTAAAGATCC
TTGACTGCCACCAACTTGTTCGTCGGTTTCGTTGGTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTT
GATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGG
AGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGT
GAATCTGCAAATGCATACCATTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGGAGGGGGCCCTGAGGGGGCCCTGG
GGAGGGAGAGAGAGGGTTTTTTCTTCTAAATACCGGATCCGGATCCGCCTCTCTTCCGGCGGGGGAGGTCGTCCCAAAACTCCATCGGATCCGCAGATCT
GGTTCATTTCAGAGGCGCATCATCGGATCAACATCCTGAAGAAGACTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAAT
CCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGTTTGCCAGATCCAACTTACCAACTGCGCCCAGA
CACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAAC
TTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTACGTCCGTGGATTGTT
CCGAATCCTAAGCGAATATTTGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTAGTT
TCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGA