Description :
From Genome Similarity Track
Location :
Scaffold_215:30700- 32281
Transcript NameFunction/comments
Phyag_g3576hypothetical protein PHYSODRAFT_332814

Sequence
1581 bases(100 bases per row)
GTCGAAGTGCTGCTCACCTCCGAACATTGTTGTCAAGTGGAAGGATACAATTGTACAGCGGACACGACCGCGTACAAATACCTTCGGCCGAGGTCCACTC
GAGCACTGAAATGGATTCCCCTTCGATTCTCCTACGGGAATCGTTCGGCGTGAACCTCTTCACTAAGCCTTCTGCATGCTGTCGTAACAATAGACAATCC
GTTCGTGAGTCAACCGACCGAGCTGTCGGCACCATCAATAGGATAGCCTCTTGCGTGGAAGGACTTGGTAGAGTTTCTGCGCAAGTGTCCGCTTCGAGCA
AGCCGCATAGAGATTACCAACCCTCGTCTTTGGTCCATTTTCAGTGAACAGGTTGCGGCAGAACGCCAGCCGGAGCATACGTGGTGAGCGCAGATGGCGA
TGTATCAGCTGCATCAGTCAAGCTCGGGAatgtccaccaccaacagctcTCCACACAATCCAAGCCTCACTTTAGTTTTACCTCTCGATCCACCACTTAC
TTCACTTCGACCAACATGAAAGGCCGATTTATCGTCAACCCgttccaggagctggaacTTACTCTGGCTGACCGcacgcagctcgaagaactgGCCAACC
AATGTATCACCACCAACCTCGAATACTTCAACAGATTTACGTCCACTTTGAAGCGTACCGTGGATGTAAACCGTTGGAAACTGTACAAGGAAGGCGAGAA
GCTCAAAGTTTACTCGGAACGATCGGGTCGTCCAGCGACTGGAGCTGTGGAGCCGACCGGGTCAGGTCTTCCGATGCTGCTTTGTGTCGGAACCATGGAG
GGCAAATTGGATGACCTCATGTACGGACTCATCAGTGAAGATCTCGAGACGATGCGGCTCAAAGCTTCGTACGTTGATGATATCAGTGGAGCAGCAGTAC
TAGATGACGTGGTACTGCCAACAGCCGAGAAGCCGTTCCAGTCATTGGTAatcaagtggatggagctTGATATCCCGCTTCGCTCGACGAATTTGGTTAA
GAACCGCGACTACGTCTACCTCGAAGGCACCGGGTACGCCCGTAGTGCCAACAATGAACGCATCGGTTATCACCTTTTGCACTCGGTGAGTTTCCCGCAA
ACTCCTGAGCTGCCGCACCGCATTCGAGGTAACATGTCGGTCATTGGATTGTGGCGTCAAGCCGGCCCTAACACGTTGGAAATGTACGCCACCGGAGTGA
TGGACCCTGTTGACACGGGTTTGATCCGAAAACTTGTGGTACCGAGTCTGGCGAACGTCTTCCTGTCCACTTTGAAGTACGCGTACTGCGGCCAGATGCG
CAAGCTCACCTTCATGCTCGACAAGAAATACGCCGAGTCGAGAGCGCGTGGCACGCCGAACAAACAGAGAATCTGCGTCACGTGCTCGGCACCCGTTAGT
AGTCGAAAACTTGGAGATTtcggcaagagcaacagcacgTGCAAGCTGTGCTTCGGGTTCGTGTGCCATGCATGTAAGATCACGAGGAAATTGAGCTTCG
TGGACCCAGATCTACTGCTGTCTCAACGCAAGGTGACGTTCTGCACAGCGTGCATCAGTGAAGTGACCAGTACGAGTGCAG