Description :
From Genome Similarity Track
Location :
scaffold_27:30691- 33427
Transcript NameFunction/comments
g1350.t1hypothetical protein
g1351.t1 conserved hypothetical protein

Sequence
2736 bases(100 bases per row)
AAAGGATGATCACTGCGTCTGTGGGCGTAGACTCGAGTCTGTTGCTGGAACCGGCGCGTGAACTGCTATTCCCAGTGCCGGACGTGACCACCGAGCATCG
GCCACGCTGCAGCCTCACGCTCACCAATCTATCGCCACTCAATGACGTGGTCTTCCGAGTGCGGACGCGCAACCCGGACGCCTTCACAGTGCGGCCGACC
CACGGGCTGGTTGTGCCCGGAGCTAGTGCCCATGTCACCATTACAGCCACTGCAAGGACTTGCAAGCGTCTGGGCGCCATGGACCCACGGGACTTGATGA
CGCGCCAGTCGTCCGAACTTTTCCTTGTGCAGAGCGTCGAGAGAGTAGAAGAAATGCAAGCCATGGAGCCACTGGACCCTCACTCCAGCACGTCGTTGCG
TGCATTCTGGAAGAAGGTACCGAAGGACTGTATTACGGAGAACAAGATGGTCTGTCGCTTTACAGCCTCGACACCGGGGGTTCGTCCTCCGCTGCCTTCC
GAAGTCACACAGGACAACAACATGTTCTCGCGTAGTATGAGTAGCGCCAGTATCAGCTCGCAGGAATATCGGTCGAGTCGCAGTGAGAACAGGAGCTTGA
GCATGAGCGCGAGGGAGACCAGGTTGAGTCGCAGCGGAAGCAGCAGCGAACGGAGTAGACTCAGTCGGTCTTTTAGCAACCAGTTTGACGATGTGAGGAG
AGAAGACCGTCGCAGTCGCCAACAATCGTTCGTCAGCGACGCTAGCTACCACACGACCATCGAACCACCGACTCCAATCAGCGGACAGAAGATGGAGGCA
AGGCTGTCTTCATCGACAGACTACGGGCTCTCAAGGACGAGACTTCGTGACACTACGCTTAGCAGTATTAGCGTGAACGACAGCTCCATCAGCGATACGA
TGCTGACTGCGCGTTCCACTGACAGTGCGGCAGGTGAACCGACGCACGAACTTGGTCCTCTGCTCTACCTCATTCAGCCAGACGATATGCTGTCATTCAA
CGTGAAGCCTGCGCCGCGCTTTTGGGGAAAAACCTCCTTCTTCATTGTGAACTCGAGTCAGAATGATTGCCTCACCTTCAAAGTGCGCACCTCGAACCAG
TCGGGCTACGTCGTTAAGCCCAGTCGAGGACTAGTGTCAACTACGAGCGCGCAGGAAGTGGTCGTATCGTTGTGTGCACCTCGCGATGAAGACTCTTTTG
ATCCCGACAAGCGTGAGGCCAAGGACGGATTTATGATCGAAGTCGCCAACATTTCGCGGGACAAGTACGCAGATTTGATAAAGCTGGACGAACGGAAACG
CACTCGCGAACTCAGTTCCCTGTGGTCTTTCATGCCCCGAAGCAATCGACAGTCGACGATGCTATCAGTGAATCTCAAAGTGGAGGGGAGCGAGTGTGAC
AGTGGCACTCACGACAGCTCCGAAAGTGGTCACTCGGATGCTCAAAGCTCGAATACTTCAGCTTCCAAAGAAAAGATGGAAGAAGCTCAAAGGCAAGGCT
TACGCTCAGTTGTCCAAGGGATGAAGCAGCTTCATATGGCGAACCAGTCATCTGATAGAACTGCTGGAAACAAGCTCCACGCTATCTACCGATACTCGGA
TTCGGACGAGTCAGCCTTCACTATCGCTCCAACTCCCGTACCTACTGAAATTGGTGATGAAAGCGATGACGAAGTGGTTTTCCCTCGACATAATGCAGCT
TCTAAAGCTCCTCAAGACTCGGCTGTGATTGTCGTCTCAGCCGACAGGATGGATACTGTCGACTTTTCCAACCCCAAGTTGTCCTTCTTTATTTAGGAGT
GCAGCAGCACTCTTCATCCTGCAGACGATGACGAAGACTGAACATTCACGAGTCCATAGCTTTCCAAAAATGTATATTCGTGAAGTTATGAATCGCAGGT
GTTTTTCTCCAAAACATAGTCTGCTTCTTGTAGGAAAGGTCGGTTACACGGGATGCTTCCATCGTTAGATGATGACTCAAAAAAGCCTCGTGTTGGGTCT
AACTACTGGTGTCAGTCAGGATCGCCTCCAAGCTCTCGAGGACCTTGACCGTTGACGACGTACCGAGCATGTTGATGATGCTGGGTGGGATGTAGCCCGC
CAGATCGGCGTGGGCCAGAAGAGTCACGACGCAGAACACCTTGCCCTCCTCCTTGAACTCCTCGATGATGTAGCCCGAAATGTAGTTGTTGGCACGCACG
TAGCCCTCGAGAGGAGCGACTTCCGCCACGTTGACGGAGCGAGTGGCAATGACAACTCGACCATCCTCAAGGGTGGTAGCATACGTGACCACCACGAACT
CCCGGCCGTAAATGGGGAACTGGCCCTTGCTGGTGATCTGACGGAAGGCCAAGTGGTTCGACTCGCCAATGTCGCGCAAAGTGACCACACCCTCCATCAT
CTCGTCCAGCTCCAGCGTGCGGTTGGGGTCCAGCAGAACCTGCTCAATAGCTCTCTTGTCAGCGTCGATGCGGCGTGCGGCACGGAACGGGCACCAATCG
CAGTCCTCGACGGCTCCGCGCCAGATCTGCACTCCGTCAGCGTCCTCCACAATCTCCCACGTGGTCACCTTGTCGTCTCCGGTGTGGCGGTTGAGCAGAA
TCTGGATGTTCTCCTTTCCGTAGGCCTCGAAGTCCACGTCGTTGGCGGTGGGGTACGCGGGCTCCTCCGGTTTCACCTGCTCTTCGGCTGCCGGTGTCTC
TCCGTACCCAAACAGGTAGTTCATAGTGGTTCTTGG