Description :
From Genome Similarity Track
Location :
Scaffold_314:30690- 32181
Transcript NameFunction/comments
Phypl_g6865hypothetical protein PHYSODRAFT_380960

Sequence
1491 bases(100 bases per row)
TACACCATTTCCCGGTCAAGTCGCTAGTTTTGTCAACCAACCTGCAAGAGGGATAAACAGGGATGAGTCAAGCAAAGAGAAACATGCATTTTTCAAGATT
TAAAAGAAACGTGCCTTTTATCGACCAAATTGCAAATCTACACTTACACACCAAGCTGCATGTCCTCGCCCCTTTCAGCAGCAAAACAATGGCCCAGGCA
GTGGCGTACGTAGCGCCATACTGGCCGGCGCGTAATAAATCCCCTGgacaccgccaccgcctccttcATCAACGCCAGCCGATGCGCGGTGTACGTATCG
TATACGACGCAAACCAAAACCTCCTGCTGTCGTTCAGCCATGGAAATCGTCATCGTGGCCTTCAAAGGTTCCAGCGTCCCTCAACGGTGTTAAGCATAGG
ACTATAGGGCTCCAGCCGGAGTACGACGAGCTTGTTCAGGTTCACGATGCCGTCTGCAGCGAGATACTCGCGTGCCAGGTTCTCTGCGTTGATGTGGGCT
GGCGCATTATCAGTGACAATCACGACCTTGGCAGGTCGAAGCTCTTCGTACTCGTCTGGCCGTAGAGCTGCGATGAACAGGTCCGCCATTAACCTGGCGT
TTTCTTTCTGTTTGACTGAGCCTTCGTGTGTTTGCAGCAGGATCAATCCCGAGCCACTGGAGACGCCACCTTGTACACGCCAGTTTTTGCCTTTGCATGG
CGGGAGTTGGACGACAGCACGTCCGCCAACACGAGACCATTCTTCCATTCTTGATAAATACAAGCTAAGTTAATTTCGCCCTGAAATATGATCATGTTAC
CTTTCTTGATGTGCTTGTTGAGCTCGTTCACGAAGGTCTTGCGCTTCCCCTTGTTGGCGCTCGAGTTCACGGTCGCCGTCTCGATGCGCAAGCTCTCCGT
GAAGTACAGCATGTGTTGGAGCGCACGTCTTGCTCACCACAGCACCCATGTCAGAGCGGAGCCGGTAGCaccgctgctccagcgtgtgACGGCAGTCCTC
ACCGATGTGTTATTCGATCTTGCGCTAGGCCTCCACAGTCATCTTGACAGAAGCTTGGCGCAGACCacagcgctgcttggcctctTGGCCAGCGGCAAGG
ATAGCGCGGTGCGTTGTGAAGTAGCTCAGGTCGTTAGACACCGCAGTCTCTCTCCAGTCCATGCCTTCTTGAAAagcacggacgacgccagcctTCGCTT
GTGCTCACTCGAAGGCGAGATGGTTATTGTGGGGGTCCGGCGGGGACGGCATTTGCAAGAATGAATGAAATGCTAAACATCGTATTGGTTGCGCGGGGTT
GGTTGGCGCTAGACGGCGCGCAGTTAGTGCCAAAATGACTGGCGGCAAGGACGTTTGGACTTTGGTCGGAAAGTGTACCCACCCGTTTTGCAAATCAAAG
AAAAATGCACGTTTTGTGGCATGCAAAATACCATTTTACCACACCTTGCAGCTGGTTGGTAAAATTTGTGACTTGACCGGGAAATGGTGTA